<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>ar2476</ui>
   <ji>ARJ</ji>
   <fm>
      <dochead>Research article</dochead>
      <bibl>
         <title>
            <p><it>Cia5d </it>regulates a new fibroblast-like synoviocyte invasion-associated gene expression signature</p>
         </title>
         <aug>
            <au id="A1">
               <snm>Laragione</snm>
               <fnm>Teresina</fnm>
               <insr iid="I1"/>
               <email>tlaragio@nshs.edu</email>
            </au>
            <au id="A2">
               <snm>Brenner</snm>
               <fnm>Max</fnm>
               <insr iid="I1"/>
               <email>mbrenner@nshs.edu</email>
            </au>
            <au id="A3">
               <snm>Li</snm>
               <fnm>Wentian</fnm>
               <insr iid="I2"/>
               <email>wli@nshs.edu</email>
            </au>
            <au id="A4" ca="yes">
               <snm>Gulko</snm>
               <mi>S</mi>
               <fnm>P&#233;rcio</fnm>
               <insr iid="I1"/>
               <insr iid="I3"/>
               <email>pgulko@nshs.edu</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Laboratory of Experimental Rheumatology, Center for Genomics and Human Genetics, Feinstein Institute for Medical Research, 350 Community Drive, Manhasset, New York 11030, USA</p>
            </ins>
            <ins id="I2">
               <p>Genomics and Human Genetics, Feinstein Institute for Medical Research, 350 Community Drive Manhasset, New York 11030, USA</p>
            </ins>
            <ins id="I3">
               <p>Department of Medicine, New York University School of Medicine, 550 First Avenue, New York, 10016, USA</p>
            </ins>
         </insg>
         <source>Arthritis Research &amp; Therapy</source>
         <issn>1478-6354</issn>
         <pubdate>2008</pubdate>
         <volume>10</volume>
         <issue>4</issue>
         <fpage>R92</fpage>
         <url>http://arthritis-research.com/content/10/4/R92</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">18706093</pubid>
               <pubid idtype="doi">10.1186/ar2476</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>18</day>
               <month>4</month>
               <year>2008</year>
            </date>
         </rec>
         <revreq>
            <date>
               <day>21</day>
               <month>5</month>
               <year>2008</year>
            </date>
         </revreq>
         <revrec>
            <date>
               <day>17</day>
               <month>7</month>
               <year>2008</year>
            </date>
         </revrec>
         <acc>
            <date>
               <day>15</day>
               <month>8</month>
               <year>2008</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>15</day>
               <month>8</month>
               <year>2008</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2008</year>
         <collab>Laragione et al.; licensee BioMed Central Ltd.</collab>
         <note>This is an open access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Introduction</p>
               </st>
               <p>The <it>in vitro </it>invasive properties of rheumatoid arthritis (RA) fibroblast-like synoviocytes (FLSs) have been shown to correlate with disease severity and radiographic damage. We recently determined that FLSs obtained from pristane-induced arthritis (PIA)-susceptible DA rats are also highly invasive in the same <it>in vitro </it>assay through Matrigel. The transfer of alleles derived from the arthritis-resistant F344 strain at the arthritis severity locus <it>Cia5d </it>(RNO10), as in DA.F344(Cia5d) congenics, was enough to significantly and specifically reduce the invasive properties of FLSs. This genetically controlled difference in FLS invasion involves increased production of soluble membrane-type 1 matrix metalloproteinase (MMP) by DA, and is dependent on increased activation of MMP-2. In the present study we aimed to characterize the pattern of gene expression that correlates with differences in invasion in order to identify pathways regulated by the <it>Cia5d </it>locus.</p>
            </sec>
            <sec>
               <st>
                  <p>Methods</p>
               </st>
               <p>Synovial tissues were collected from DA and DA.F344(Cia5d) rats 21 days after the induction of PIA. Tissues were digested and FLSs isolated. After a minimum of four passages, FLSs were plated on Matrigel-covered dishes at similar densities, followed by RNA extraction. Illumina RatRef-12 expression BeadChip arrays were used. Expression data were normalized, followed by <it>t</it>-test, logistic regression, and cluster analysis. Real-time PCR was used to validate the microarray data.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>Out of the 22,523 RefSeq gene probes present in the array, 7,665 genes were expressed by the FLSs. The expression of 66 genes was significantly different between the DA and DA.F344(Cia5d) FLSs (<it>P </it>&lt; 0.01). Nineteen of the 66 differentially expressed genes (28.7%) are involved in the regulation of cell cycle progression or cancer-associated phenotypes, such as invasion and contact inhibition. These included <it>Cxcl10</it>, <it>Vil2 </it>and <it>Nras</it>, three genes that are upregulated in DA and known to regulate MMP-2 expression and activation. Nine of the 66 genes (13.6%) are involved in the regulation of estrogen receptor signaling or transcription. Five candidate genes located within the <it>Cia5d </it>interval were also differentially expressed.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusions</p>
               </st>
               <p>We have identified a novel FLS invasion associated gene expression signature that is regulated by <it>Cia5d</it>. Many of the genes found to be differentially expressed were previously implicated in cancer cell phenotypes, including invasion. This suggests a parallel in the behavior of arthritis FLSs and cancer cells, and identifies novel pathways and genes for therapeutic intervention and prognostication.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <meta>
      <classifications>
         <classification type="bmc" subtype="user_supplied_xml" id="endnote"/>
      </classifications>
   </meta>
   <bdy>
      <sec>
         <st>
            <p>Introduction</p>
         </st>
         <p>Rheumatoid arthritis (RA) is a common chronic autoimmune disease that affects approximately 1% of the population <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. It is a complex trait, in which genetic and environmental factors mediate disease susceptibility and severity <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. Basic joint pathology in RA is characterized by pronounced synovial hyperplasia, also called 'pannus', which produces several proinflammatory cytokines and proteases and, like a malignant tumor, invades and destroys cartilage and bone <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B3">3</abbr><abbr bid="B4">4</abbr></abbrgrp>.</p>
         <p>The formation of the synovial pannus is regulated by complex interactions between synovial resident cells and infiltrating inflammatory cells <abbrgrp><abbr bid="B5">5</abbr><abbr bid="B6">6</abbr></abbrgrp>, and their production of paracrine and autocrine factors such as cytokines and growth factors <abbrgrp><abbr bid="B7">7</abbr><abbr bid="B8">8</abbr><abbr bid="B9">9</abbr></abbrgrp>, nuclear factor-kB activation <abbrgrp><abbr bid="B10">10</abbr></abbrgrp>, and angiogenesis <abbrgrp><abbr bid="B11">11</abbr></abbrgrp>. The fibroblast-like synoviocyte (FLS) is a key player in this process, and its numbers are markedly increased in the hyperplastic synovial pannus of RA and rodent models of arthritis <abbrgrp><abbr bid="B4">4</abbr></abbrgrp>. RA FLSs invade cartilage <abbrgrp><abbr bid="B12">12</abbr></abbrgrp> and produce increased amounts of several proteolytic enzymes that further contribute to joint destruction <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B3">3</abbr></abbrgrp>. The invasive properties of RA FLSs have also been associated with radiographic damage in RA, a parameter of disease severity, which emphasizes their direct clinical relevance <abbrgrp><abbr bid="B13">13</abbr></abbrgrp>.</p>
         <p>We have previously identified <it>Cia5d </it>as an arthritis severity locus and showed that DA.F344(Cia5d) rats congenic for this interval developed significantly milder arthritis, with nearly no pannus formation and neither bone nor cartilage destruction, as compared with highly susceptible DA rats <abbrgrp><abbr bid="B14">14</abbr></abbrgrp>. We also determined that <it>Cia5d </it>regulates the invasive properties of FLSs, thus providing an explanation for its role in joint damage <abbrgrp><abbr bid="B15">15</abbr></abbrgrp>. The arthritis gene located within <it>Cia5d </it>controls the FLS production of soluble membrane-type 1 (MT1)-matrix metalloproteinase (MMP) and activation of MMP-2 <abbrgrp><abbr bid="B15">15</abbr></abbrgrp>. This was the first time that FLS phenotypes were found to be genetically regulated.</p>
         <p>In the present study we took advantage of this genetically regulated FLS invasive phenotype and compared highly invasive with minimally invasive cells' gene expression signatures using microarrays. The study of more than 22,000 genes identified a gene expression signature related to invasion that is differentially regulated between FLSs from DA and DA.F344(Cia5d) rats. The novel FLS invasion pathways described here resemble those described in cancer cell lines and have the potential to become novel targets for therapeutic intervention.</p>
      </sec>
      <sec>
         <st>
            <p>Materials and methods</p>
         </st>
         <sec>
            <st>
               <p>Rats</p>
            </st>
            <p>DA (DA/BklArbNsi, arthritis-susceptible) inbred rats (originally from Bentin &amp; Kingman, CA, USA) were maintained at the Arthritis and Rheumatism Branch (Arb; National Institutes of Health) and then transferred to the Feinstein Institute (previously named North Shore-LIJ Institute; Nsi). The genotype-guided breeding of DA.F344(Cia5d) was previously described in detail <abbrgrp><abbr bid="B14">14</abbr></abbrgrp>. Briefly, a 37.2 megabase interval on rat chromosome 10 was transferred from F344 into the DA background over 10 backcrosses followed by at least five intercrosses (Figure <figr fid="F1">1</figr>). The experiments were conducted with rats homozygous at the congenic interval. All experiments involving animals were reviewed and approved by the Feinstein Institute for Medical Research Institutional Animal Care and Use Committee. Animals were housed in a pathogen free environment, on 12-hour light and dark cycles, with free access to food and water.</p>
            <fig id="F1">
               <title>
                  <p>Figure 1</p>
               </title>
               <caption>
                  <p>Map of <it>Cia5d </it>congenic interval</p>
               </caption>
               <text>
                  <p>Map of <it>Cia5d </it>congenic interval. Markers used in the breeding of DA.F344(Cia5d) congenics and their positions on chromosome 10. Numbers represent the position in the chromosomes. Mb, megabases.</p>
               </text>
               <graphic file="ar2476-1"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>Induction of PIA and arthritis scoring</p>
            </st>
            <p>Rats aged 8 to 12 weeks received 150 &#956;l of pristane by intradermal injection divided into two sites at the base of the tail <abbrgrp><abbr bid="B14">14</abbr><abbr bid="B16">16</abbr></abbrgrp>. The animals were scored on days 14, 18 and 21 after pristane induction using a previously described arthritis scoring system <abbrgrp><abbr bid="B17">17</abbr><abbr bid="B18">18</abbr></abbrgrp>. On day 21 after injection, the animals were killed and synovial tissue was collected from the ankles for FLS isolation.</p>
         </sec>
         <sec>
            <st>
               <p>Isolation and culture of primary FLS</p>
            </st>
            <p>FLSs were isolated by enzymatic digestion of the synovial tissue. Briefly, tissues were minced and incubated with a solution containing DNase 0.15 mg/ml, hyaluronidase type I-S 0.15 mg/ml, and collagenase type IA 1 mg/ml (Sigma-Aldrich, St. Louis, MO, USA) in Dulbecco's modified Eagle's medium (DMEM; Gibco, Invitrogen Corporation, Carlsbad, CA, USA) for 1 hour at 37&#176;C. Cells were washed and re-suspended in DMEM supplemented with 10% fetal bovine serum (Gibco), glutamine 30 mg/ml, amphotericin B 250 &#956;g/ml (Sigma), and gentamicin 10 mg/ml (Gibco). After overnight culture, nonadherent cells were removed and adherent cells were cultured. All experiments were performed with cells after passage four (95% FLS purity).</p>
         </sec>
         <sec>
            <st>
               <p>Flow-cytometric characterization of FLSs</p>
            </st>
            <p>Freshly trypsinized FLSs (105) were re-suspended in phosphate-buffered saline with 0.02% azide (Sigma-Aldrich) and 1% bovine serum albumin (P Biomedicals, Aurora, OH, USA), and incubated with 1 &#956;g anti-CD32 (Pharmingen, San Diego, CA, USA) to block Fc&#947; II receptors. Cells were stained with saturating concentrations of CD90 (OX-7; PerCP, Pharmingen) or isotype control. Stained cells were fixed with 1% paraformaldehyde in phosphate-buffered saline and analyzed by flow cytometry in a FACSCalibur (Becton Dickinson, Franklin Lakes, NJ, USA), using the BD Cell-Quest&#8482; Pro version 4.0.1 software (Becton Dickinson).</p>
         </sec>
         <sec>
            <st>
               <p>FLS culture on Matrigel</p>
            </st>
            <p>We previously studied the invasive properties of FLSs through a collagen matrix (Matrigel). Cell interactions with the extracellular matrix are known to influence the expression of several genes, including activation of MMP-2 <abbrgrp><abbr bid="B19">19</abbr></abbrgrp>, which is a key mediator of the FLS invasive phenotype. Therefore, in order to study the gene expression signature of highly invasive and minimally invasive FLSs, cells were cultured under the same conditions as used in the invasion studies. Specifically, 100% confluent 75 cm<sup>2 </sup>FLS culture flasks were trypsinized (trypsin 0.25% with EDTA 0.1%). The rates of cellular proliferation differed among cell lines, and we previously showed that FLS proliferation does not correlate with the FLS invasive behavior. In order to have similar cell confluence at the time of FLS harvesting for RNA extraction, 10% to 50% of the high-density 75 cm<sup>2 </sup>cell culture flasks (depending on the cell line) were plated in Matrigel-coated 10 cm culture dishes (Becton Dickinson) with DMEM, 10% fetal bovine serum, antibiotics, and glutamine. Cell cultures were maintained at 37&#176;C with 5% carbon dioxide for 24 hours. After 24 hours, FLSs were harvested using a cell scraper (Corning, Acton, MA, USA) followed by digestion of the Matrigel with 10 ml collagenase D 1 mg/ml (Roche Applied Science, Indianapolis, IN, USA) at 37&#176;C for 10 minutes. FLSs were then collected by centrifugation, washed twice with ice-cold phosphate-buffered saline. Cell pellets were re-suspended in RLT lysis buffer (RNeasy Mini Kit; Qiagen, Valencia, CA, USA) with 1% (vol/vol) &#946;-mercaptoethanol (Sigma). Cell-lysis buffer suspension was vortexed, frozen in liquid nitrogen and stored at -80&#176;C until RNA extraction.</p>
         </sec>
         <sec>
            <st>
               <p>RNA extraction and quality assessment</p>
            </st>
            <p>Cells in RLT buffer were disrupted using QIAshredder spin columns (Qiagen), and total RNA was extracted using the RNeasy Mini Kit (Qiagen), in accordance with the manufacturer's instructions. Samples were digested with DNase (Qiagen) and eluted with 30 &#956;l RNase-free water. RNAs were quantified and assessed for purity using a NanoDrop spectrophotometer (Rockland, DE, USA). RNA integrity was verified with a BioAnalyzer 2100 (Agilent, Palo Alto, CA, USA).</p>
         </sec>
         <sec>
            <st>
               <p>RNA preparation and microarray experiments</p>
            </st>
            <p>The RatRef-12 Expression BeadChip contains 22,524 probes for a total of 22,228 rat genes selected primarily from the NCBI RefSeq database (Release 16; Illumina, San Diego, CA, USA), and was used in accordance with the manufacturer's instructions. All reagents have been optimized for use with Illumina's Whole-Genome Expression platform. Total RNA 200 ng was used for cRNA <it>in vitro </it>transcription and labeling with the TotalPrep&#8482; RNA Labeling Kit using Biotinylated-UTP (Ambion, Austin, TX, USA). Hybridization is carried out in Illumina Intellihyb chambers at 58&#176;C for 18.5 hours, which is followed by washing and staining, in accordance with the Illumina Hybridization System Manual. The signal was developed by staining with Cy3-streptavidin. The BeadChip was scanned on a high resolution Illumina BeadArray reader, using a two-channel, 0.8 &#956;m resolution confocal laser scanner.</p>
         </sec>
         <sec>
            <st>
               <p>Data extraction and normalization</p>
            </st>
            <p>The Illumina BeadStudio software (Version 2.0) was used to extract and normalize the expression data (fluorescence intensities) for the mean intensity of all 12 arrays. Genes expressed in all 12 arrays were selected for analyses. Normalized data were analyzed using the <it>t</it>-test and logistic regression.</p>
         </sec>
         <sec>
            <st>
               <p>Statistics and analyses</p>
            </st>
            <p>The <it>t</it>-test was used to compare means of the log-transformed and non-log-transformed data. Genes with a <it>P </it>value under 0.01 between DA and DA.F344(Cia5d) were considered significant and included in additional analysis. The logistic regression model fitting was carried out as previously described <abbrgrp><abbr bid="B20">20</abbr><abbr bid="B21">21</abbr></abbrgrp> using the filtered gene list. The statistical significance of a logistic regression result was obtained by comparing the deviance with the 'null deviance'. This null deviance is the (-2)log-likelihood of a random model in which the probability for a sample to belong to a group (for example, DA) is equal to the proportion of DA samples in the dataset. The difference between the deviance and the null deviance follows the &#967;<sup>2 </sup>distribution with one degree of freedom by chance alone, and this &#967;<sup>2 </sup>distribution was used to determine the <it>P </it>value. The R statistical package <abbrgrp><abbr bid="B22">22</abbr></abbrgrp> was used for <it>t</it>-test and logistic regression analyses.</p>
            <p>The Ingenuity IPA 5.5.1 program (Ingenuity, Redwood City, CA, USA) and PubMed and GEO (Gene Expression Omnibus) searches were used for pathways detection. CLUSTER <abbrgrp><abbr bid="B23">23</abbr></abbrgrp> and TREEVIEW <abbrgrp><abbr bid="B24">24</abbr></abbrgrp> were used for cluster analysis and generation of a heat map.</p>
         </sec>
         <sec>
            <st>
               <p>Quantitative real-time PCR</p>
            </st>
            <p>The same RNA used for the microarray experiments was also used for the quantitative real-time PCR confirmation experiments. Total RNA 200 ng from each sample was used for cDNA synthesis using the Superscript III kit (Invitrogen). Primers and probe sequences were designed to target the same exon as used in the Illumina RatRef-12 Expression BeadChip. We used Exiqon (Woburn, MA, USA) and Taqman (ABI, Applied Biosystems, Foster City, CA) probes (Table <tblr tid="T1">1</tblr>). GAPDH was used as endogenous control. Probes were labeled with FAM at the 5' end and TAMRA at 3' end and used at a final concentration of 100 nmol/l. Primers were used at 200 nmol/l concentration with Eurogentec quantitative real-time PCR mastermix (Eurogentec, San Diego, CA, USA). The ABI 7700 quantitative real-time PCR thermocycler was used at 48&#176;C for 30 minutes, 95&#176;C for 10 minutes, and 45 cycles of 95&#176;C for 0.15 minutes and 60&#176;C for 1 minute. Samples were run in duplicates and the means used for analysis. Data were analyzed using Sequence Detection System software version 1.9.1 (ABI). Results were obtained as Ct (threshold cycle) values. Relative expression of all the genes was adjusted for GAPDH in each sample (&#916;Ct), and &#916;Ct used for <it>t</it>-test analysis. Quantitative real-time PCR fold differences were calculated with 2<sup>-&#916;&#916;Ct </sup><abbrgrp><abbr bid="B25">25</abbr></abbrgrp>.</p>
            <tbl id="T1">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p>Genes studied with QPCR for confirmatory studies, primers and probe sequences</p>
               </caption>
               <tblbdy cols="6">
                  <r>
                     <c ca="left">
                        <p>
                           <b>Accession number</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Gene symbol</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Target exon<sup>b</sup></b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Probe</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Forward primer</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Reverse primer</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Up-regulated in DA</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>NM_139089.1</p>
                     </c>
                     <c ca="left">
                        <p>Cxcl10</p>
                     </c>
                     <c ca="center">
                        <p>4</p>
                     </c>
                     <c ca="center">
                        <p>Exiqon Universal probe 67</p>
                     </c>
                     <c ca="left">
                        <p>TTCGGACCAGCTCTTAGAGAA</p>
                     </c>
                     <c ca="left">
                        <p>GCCTGGTCCTGAGACAAAAG</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>XM_220552.3</p>
                     </c>
                     <c ca="left">
                        <p>Trim16</p>
                     </c>
                     <c ca="center">
                        <p>6</p>
                     </c>
                     <c ca="center">
                        <p>Exiqon Universal probe 1</p>
                     </c>
                     <c ca="left">
                        <p>GTGAACTCCTTCCCACTCCA</p>
                     </c>
                     <c ca="left">
                        <p>CAGCTGCATTTCTGGAAACA</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>NM_017207.1</p>
                     </c>
                     <c ca="left">
                        <p>Trpv2</p>
                     </c>
                     <c ca="center">
                        <p>15</p>
                     </c>
                     <c ca="center">
                        <p>Exiqon Universal probe 6</p>
                     </c>
                     <c ca="left">
                        <p>CTCTTCCCACCTTATCTGAGGA</p>
                     </c>
                     <c ca="left">
                        <p>GACCTGAAGGGGCAGATG</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>NM_019357.1</p>
                     </c>
                     <c ca="left">
                        <p>Vil2</p>
                     </c>
                     <c ca="center">
                        <p>13</p>
                     </c>
                     <c ca="center">
                        <p>CCCCAAGACCCAGTGGAATCCTCC<sup>a</sup></p>
                     </c>
                     <c ca="left">
                        <p>AGGTACCGGGCGATGTTCT</p>
                     </c>
                     <c ca="left">
                        <p>GGCCTGTTTGGCACTATGTGA</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>LOC309362</p>
                     </c>
                     <c ca="left">
                        <p>Dnmbp</p>
                     </c>
                     <c ca="center">
                        <p>16</p>
                     </c>
                     <c ca="center">
                        <p>Exiqon Universal probe 97</p>
                     </c>
                     <c ca="left">
                        <p>TTGTCTCAGCATGGGTCCTA</p>
                     </c>
                     <c ca="left">
                        <p>ACCAGGATTTTAAGGCCACA</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>NM_001107408</p>
                     </c>
                     <c ca="left">
                        <p>Gins3</p>
                     </c>
                     <c ca="center">
                        <p>3&#8211;4</p>
                     </c>
                     <c ca="center">
                        <p>Exiqon Universal probe 17</p>
                     </c>
                     <c ca="left">
                        <p>GTCGTGGACCTCCACAAAAT</p>
                     </c>
                     <c ca="left">
                        <p>GAACCGTCCAATAAAAGTCTGC</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Down-regulated in DA</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>XM_235434.4</p>
                     </c>
                     <c ca="left">
                        <p>Gsdmdc1</p>
                     </c>
                     <c ca="center">
                        <p>13</p>
                     </c>
                     <c ca="center">
                        <p>Exiqon Universal probe 68</p>
                     </c>
                     <c ca="left">
                        <p>AGCACGTCTTGGAACAGAGC</p>
                     </c>
                     <c ca="left">
                        <p>TCCTCATCCCAGCTGTCC</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>XM_222868.4</p>
                     </c>
                     <c ca="left">
                        <p>Olfml2b</p>
                     </c>
                     <c ca="center">
                        <p>8</p>
                     </c>
                     <c ca="center">
                        <p>Exiqon Universal probe 106</p>
                     </c>
                     <c ca="left">
                        <p>CTCCCTTCTTCCATGCTCTG</p>
                     </c>
                     <c ca="left">
                        <p>GCAAGCCCCAGAGGAATAA</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>NM_001008321.1</p>
                     </c>
                     <c ca="left">
                        <p>Gadd45b</p>
                     </c>
                     <c ca="center">
                        <p>4</p>
                     </c>
                     <c ca="center">
                        <p>Exiqon Universal probe 25</p>
                     </c>
                     <c ca="left">
                        <p>ACAGGTGGTCGCCAAGAC</p>
                     </c>
                     <c ca="left">
                        <p>CCAGGCCTTGGCTCTAAAGT</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Estrogen receptors</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>NM_012689.1</p>
                     </c>
                     <c ca="left">
                        <p>Esr1</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>Exiqon Universal probe 67</p>
                     </c>
                     <c ca="left">
                        <p>GCAAGAATGTCGTGCCTCTC</p>
                     </c>
                     <c ca="left">
                        <p>TGAAGACGATGAGCATCCAG</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>NM_012754</p>
                     </c>
                     <c ca="left">
                        <p>Esr2</p>
                     </c>
                     <c ca="center">
                        <p>-</p>
                     </c>
                     <c ca="center">
                        <p>Exiqon Universal probe 94</p>
                     </c>
                     <c ca="left">
                        <p>CCTTGAAGGCTCTCGGTGTA</p>
                     </c>
                     <c ca="left">
                        <p>CAGAACCTTTCAGATGTTTCCA</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p><sup>a</sup>Taqman probe. <sup>b</sup>Same region used in the Illumina microarray.</p>
               </tblfn>
            </tbl>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Results</p>
         </st>
         <sec>
            <st>
               <p>Characterization of the FLS cell lines used</p>
            </st>
            <p>In previous studies we determined that DA FLSs were highly invasive, and that alleles derived from the arthritis-resistant strain F344 at the <it>Cia5d </it>interval, as in DA.F344(Cia5d) congenics (Figure <figr fid="F1">1</figr>), specifically reduced the invasive properties of FLSs. Additionally, FLSs from DA and DA.F344(Cia5d) strains expressed similar mRNA levels of transforming growth factor-&#946;, tumor necrosis factor-&#945;, IL-1&#946; and IL-6, as well as MMP-1, MMP-2, MMP-3, MMP-9, MMP-13, MT1-MMP and MT2-MMP <abbrgrp><abbr bid="B15">15</abbr></abbrgrp>. Both strains had similar collagenase and MMP-3 activity, but levels of soluble MT1-MMP and active MMP-2 were increased in DA. MMP-2 inhibition reduced DA FLS invasion to levels similar to those of DA.F344(Cia5d). Cytoskeleton characteristics were also similar in DA and DA.F344(Cia5d) FLSs <abbrgrp><abbr bid="B15">15</abbr></abbrgrp>.</p>
            <p>In the present study FLSs were stained with CD90, a marker for FLS <abbrgrp><abbr bid="B26">26</abbr></abbrgrp>, and analyzed by flow cytometry. Comparable numbers of CD90<sup>+ </sup>cells were detected both in five different DA and five different DA.F344(Cia5d) rats (percentage of CD90<sup>+ </sup>cells [mean &#177; standard deviation]: DA 95.46 &#177; 8.9 and DA.F344 [Cia5d] 96.51 &#177; 5.9), demonstrating that the cell lines were homogeneously CD90<sup>+</sup>.</p>
         </sec>
         <sec>
            <st>
               <p>Genes expressed by FLSs and filtering criteria</p>
            </st>
            <p>A total of 7,665 genes out of 22,228 genes represented in the Illumina RatRef-12 BeadChip were expressed by both DA and DA.F344(Cia5d) FLSs. Log transformation did not significantly affect the list of differentially expressed genes, and therefore results are shown from analyses done with non-log-transformed data.</p>
         </sec>
         <sec>
            <st>
               <p>Genes differentially expressed between DA and DA.F344(Cia5d) FLSs</p>
            </st>
            <p>Sixty-six genes had a <it>P </it>value under 0.01 (Tables <tblr tid="T2">2</tblr> and <tblr tid="T3">3</tblr>) and were used for fold change calculations and pathway detection analyses. Thirty-six genes were expressed in increased levels by DA FLSs, and the presence of F344 alleles at the <it>Cia5d </it>interval, as in DA.F344(Cia5d) congenics FLSs, was enough to reduce their expression significantly (Table <tblr tid="T2">2</tblr>). Thirty genes were expressed in reduced levels in DA and significantly increased in DA.F344(Cia5d) FLSs (Table <tblr tid="T3">3</tblr>). These observations demonstrate that alleles within the <it>Cia5d </it>interval, the only genetic difference between DA and DA.F344(Cia5d), are directly or indirectly involved in the regulation of the expression of several genes, and the difference in gene expression correlates with the difference in invasive properties of FLSs. Furthermore, cluster analysis separated DA FLSs from DA.F344(Cia5d) FLSs, demonstrating that the two strains could be reliably differentiated by gene expression (Figure <figr fid="F2">2</figr>).</p>
            <tbl id="T2">
               <title>
                  <p>Table 2</p>
               </title>
               <caption>
                  <p>Genes with reduced expression in synovial fibroblasts from DA.F344 (Cia5d) compared with highly invasive DA, including those associated with cancer-phenotypes and estrogen signaling</p>
               </caption>
               <tblbdy cols="8">
                  <r>
                     <c ca="center">
                        <p>
                           <b>Gene Symbol<sup>d</sup></b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Definition<sup>a</sup></b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Accession number</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>DA mean</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Cia5d mean</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Fold change</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>P value<sup>b</sup></b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Overall rank<sup>c</sup></b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="8">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c cspan="8" ca="left">
                        <p>
                           <b>Cancer, Cell Cycle, DNA replication, recombination and repair</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>
                              <it>Trim16_predicted</it>
                              <sup>e</sup>
                           </b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Tripartite motif protein 16 (predicted)</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>XM_220552.3</p>
                     </c>
                     <c ca="center">
                        <p>262.14</p>
                     </c>
                     <c ca="center">
                        <p>82.27</p>
                     </c>
                     <c ca="center">
                        <p>-3.2</p>
                     </c>
                     <c ca="center">
                        <p>0.0033</p>
                     </c>
                     <c ca="center">
                        <p>23</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>
                              <it>Cxcl10</it>
                           </b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Chemokine (C-X-C motif) ligand 10<sup>f</sup></b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>NM_139089.1</p>
                     </c>
                     <c ca="center">
                        <p>1218.54</p>
                     </c>
                     <c ca="center">
                        <p>434.48</p>
                     </c>
                     <c ca="center">
                        <p>-2.8</p>
                     </c>
                     <c ca="center">
                        <p>0.0001</p>
                     </c>
                     <c ca="center">
                        <p>2</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Dnmbp</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Similar to Dynamin binding protein (Scaffold protein Tuba)</p>
                     </c>
                     <c ca="center">
                        <p>XM_219860.3</p>
                     </c>
                     <c ca="center">
                        <p>739.97</p>
                     </c>
                     <c ca="center">
                        <p>385.61</p>
                     </c>
                     <c ca="center">
                        <p>-1.9</p>
                     </c>
                     <c ca="center">
                        <p>0.0088</p>
                     </c>
                     <c ca="center">
                        <p>62</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>
                              <it>Vil2</it>
                           </b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Villin 2 (Ezrin)<sup>f</sup></b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>NM_019357.1</p>
                     </c>
                     <c ca="center">
                        <p>1642.95</p>
                     </c>
                     <c ca="center">
                        <p>984.09</p>
                     </c>
                     <c ca="center">
                        <p>-1.7</p>
                     </c>
                     <c ca="center">
                        <p>0.0023</p>
                     </c>
                     <c ca="center">
                        <p>15</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Nras</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Neuroblastoma RAS viral (v-ras) oncogene homolog<sup>f</sup></p>
                     </c>
                     <c ca="center">
                        <p>XM_579607.1</p>
                     </c>
                     <c ca="center">
                        <p>910.25</p>
                     </c>
                     <c ca="center">
                        <p>601.06</p>
                     </c>
                     <c ca="center">
                        <p>-1.5</p>
                     </c>
                     <c ca="center">
                        <p>0.0087</p>
                     </c>
                     <c ca="center">
                        <p>60</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Brms1l_predicted</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Breast cancer metastasis-suppressor 1-like (predicted)</p>
                     </c>
                     <c ca="center">
                        <p>XM_216712.3</p>
                     </c>
                     <c ca="center">
                        <p>187.93</p>
                     </c>
                     <c ca="center">
                        <p>125.37</p>
                     </c>
                     <c ca="center">
                        <p>-1.5</p>
                     </c>
                     <c ca="center">
                        <p>0.0094</p>
                     </c>
                     <c ca="center">
                        <p>64</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Hnrpd</it>
                           <sup>e</sup>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37 kDa)</p>
                     </c>
                     <c ca="center">
                        <p>NM_024404.1</p>
                     </c>
                     <c ca="center">
                        <p>2909.16</p>
                     </c>
                     <c ca="center">
                        <p>1959.49</p>
                     </c>
                     <c ca="center">
                        <p>-1.5</p>
                     </c>
                     <c ca="center">
                        <p>0.0010</p>
                     </c>
                     <c ca="center">
                        <p>8</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Rpa2</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Replication protein A2</p>
                     </c>
                     <c ca="center">
                        <p>NM_021582.1</p>
                     </c>
                     <c ca="center">
                        <p>1583.81</p>
                     </c>
                     <c ca="center">
                        <p>1154.73</p>
                     </c>
                     <c ca="center">
                        <p>-1.4</p>
                     </c>
                     <c ca="center">
                        <p>0.0074</p>
                     </c>
                     <c ca="center">
                        <p>48</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Ube2d3</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Ubiquitin-conjugating enzyme E2D 3</p>
                     </c>
                     <c ca="center">
                        <p>NM_031237.1</p>
                     </c>
                     <c ca="center">
                        <p>123.48</p>
                     </c>
                     <c ca="center">
                        <p>99.45</p>
                     </c>
                     <c ca="center">
                        <p>-1.2</p>
                     </c>
                     <c ca="center">
                        <p>0.0017</p>
                     </c>
                     <c ca="center">
                        <p>10</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Lsm8_predicted</it>
                           <sup>e</sup>
                        </p>
                     </c>
                     <c ca="left">
                        <p>LSM8 homolog, U6 small nuclear RNA associated (S. cerevisiae) (predicted)</p>
                     </c>
                     <c ca="center">
                        <p>XM_216102.3</p>
                     </c>
                     <c ca="center">
                        <p>3766.75</p>
                     </c>
                     <c ca="center">
                        <p>3121.49</p>
                     </c>
                     <c ca="center">
                        <p>-1.2</p>
                     </c>
                     <c ca="center">
                        <p>0.0024</p>
                     </c>
                     <c ca="center">
                        <p>16</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Smc1l1</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Structural maintenance of chromosomes 1 like 1 (S. cerevisiae)</p>
                     </c>
                     <c ca="center">
                        <p>NM_031683.1</p>
                     </c>
                     <c ca="center">
                        <p>4648.45</p>
                     </c>
                     <c ca="center">
                        <p>3923.73</p>
                     </c>
                     <c ca="center">
                        <p>-1.2</p>
                     </c>
                     <c ca="center">
                        <p>0.0044</p>
                     </c>
                     <c ca="center">
                        <p>30</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Rpa3_predicted</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Replication protein A3 (predicted)</p>
                     </c>
                     <c ca="center">
                        <p>XM_216097.3</p>
                     </c>
                     <c ca="center">
                        <p>4013.83</p>
                     </c>
                     <c ca="center">
                        <p>3410.52</p>
                     </c>
                     <c ca="center">
                        <p>-1.2</p>
                     </c>
                     <c ca="center">
                        <p>0.0022</p>
                     </c>
                     <c ca="center">
                        <p>14</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Cell Signaling</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Stip1</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Stress-induced phosphoprotein 1 (Stip1)</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>NM_138911.2</p>
                     </c>
                     <c ca="center">
                        <p>3478.09</p>
                     </c>
                     <c ca="center">
                        <p>2568.75</p>
                     </c>
                     <c ca="center">
                        <p>-1.4</p>
                     </c>
                     <c ca="center">
                        <p>0.0028</p>
                     </c>
                     <c ca="center">
                        <p>18</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Ubiquitination</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Usp24_predicted</p>
                     </c>
                     <c ca="left">
                        <p>Ubiquitin specific protease 24 (predicted)</p>
                     </c>
                     <c ca="center">
                        <p>XM_233260.3</p>
                     </c>
                     <c ca="center">
                        <p>111.07</p>
                     </c>
                     <c ca="center">
                        <p>74.14</p>
                     </c>
                     <c ca="center">
                        <p>-1.5</p>
                     </c>
                     <c ca="center">
                        <p>0.0037</p>
                     </c>
                     <c ca="center">
                        <p>25</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Stub1_predicted</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>STIP1 homology and U-Box containing protein 1 (predicted)</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>XM_213270.3</p>
                     </c>
                     <c ca="center">
                        <p>4967.20</p>
                     </c>
                     <c ca="center">
                        <p>4164.69</p>
                     </c>
                     <c ca="center">
                        <p>-1.2</p>
                     </c>
                     <c ca="center">
                        <p>0.0034</p>
                     </c>
                     <c ca="center">
                        <p>24</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Ribosomal Proteins</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Rps6</p>
                     </c>
                     <c ca="left">
                        <p>Ribosomal protein S6 (Rps6)</p>
                     </c>
                     <c ca="center">
                        <p>NM_017160.1</p>
                     </c>
                     <c ca="center">
                        <p>29305.46</p>
                     </c>
                     <c ca="center">
                        <p>24538.18</p>
                     </c>
                     <c ca="center">
                        <p>-1.2</p>
                     </c>
                     <c ca="center">
                        <p>0.0085</p>
                     </c>
                     <c ca="center">
                        <p>57</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>LOC300278</p>
                     </c>
                     <c ca="left">
                        <p>Similar to 40S ribosomal protein S9</p>
                     </c>
                     <c ca="center">
                        <p>XM_213106.3</p>
                     </c>
                     <c ca="center">
                        <p>28115.69</p>
                     </c>
                     <c ca="center">
                        <p>26209.24</p>
                     </c>
                     <c ca="center">
                        <p>-1.1</p>
                     </c>
                     <c ca="center">
                        <p>0.0086</p>
                     </c>
                     <c ca="center">
                        <p>59</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>LOC367102</p>
                     </c>
                     <c ca="left">
                        <p>Similar to 40S ribosomal protein S9</p>
                     </c>
                     <c ca="center">
                        <p>XM_345948.2</p>
                     </c>
                     <c ca="center">
                        <p>25678.47</p>
                     </c>
                     <c ca="center">
                        <p>23353.32</p>
                     </c>
                     <c ca="center">
                        <p>-1.1</p>
                     </c>
                     <c ca="center">
                        <p>0.0043</p>
                     </c>
                     <c ca="center">
                        <p>28</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Others</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Trpv2</p>
                     </c>
                     <c ca="left">
                        <p>Transient receptor potential cation channel, subfamily V, member 2</p>
                     </c>
                     <c ca="center">
                        <p>NM_017207.1</p>
                     </c>
                     <c ca="center">
                        <p>177.90</p>
                     </c>
                     <c ca="center">
                        <p>92.25</p>
                     </c>
                     <c ca="center">
                        <p>-1.9</p>
                     </c>
                     <c ca="center">
                        <p>0.0075</p>
                     </c>
                     <c ca="center">
                        <p>49</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Gins3_predicted<sup>e</sup></b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>GINS complex subunit 3 (Psf3 homolog) </b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>XM_226235.2</p>
                     </c>
                     <c ca="center">
                        <p>171.57</p>
                     </c>
                     <c ca="center">
                        <p>89.64</p>
                     </c>
                     <c ca="center">
                        <p>-1.9</p>
                     </c>
                     <c ca="center">
                        <p>0.0010</p>
                     </c>
                     <c ca="center">
                        <p>6</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>LOC499310</p>
                     </c>
                     <c ca="left">
                        <p>Similar to cell division cycle associated 5</p>
                     </c>
                     <c ca="center">
                        <p>XM_574612.1</p>
                     </c>
                     <c ca="center">
                        <p>450.69</p>
                     </c>
                     <c ca="center">
                        <p>270.81</p>
                     </c>
                     <c ca="center">
                        <p>-1.7</p>
                     </c>
                     <c ca="center">
                        <p>0.0061</p>
                     </c>
                     <c ca="center">
                        <p>44</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>LOC298186</p>
                     </c>
                     <c ca="left">
                        <p>Similar to hypothetical protein FLJ33868 (predicted)</p>
                     </c>
                     <c ca="center">
                        <p>XM_238399.3</p>
                     </c>
                     <c ca="center">
                        <p>271.10</p>
                     </c>
                     <c ca="center">
                        <p>177.29</p>
                     </c>
                     <c ca="center">
                        <p>-1.5</p>
                     </c>
                     <c ca="center">
                        <p>0.0070</p>
                     </c>
                     <c ca="center">
                        <p>46</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Terf1_predicted</p>
                     </c>
                     <c ca="left">
                        <p>Telomeric repeat binding factor 1 (predicted)</p>
                     </c>
                     <c ca="center">
                        <p>XM_238387.3</p>
                     </c>
                     <c ca="center">
                        <p>98.95</p>
                     </c>
                     <c ca="center">
                        <p>66.02</p>
                     </c>
                     <c ca="center">
                        <p>-1.5</p>
                     </c>
                     <c ca="center">
                        <p>0.0048</p>
                     </c>
                     <c ca="center">
                        <p>34</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>LOC308004</p>
                     </c>
                     <c ca="left">
                        <p>Similar to hypothetical protein FLJ13188 (predicted)</p>
                     </c>
                     <c ca="center">
                        <p>XM_217663.3</p>
                     </c>
                     <c ca="center">
                        <p>573.01</p>
                     </c>
                     <c ca="center">
                        <p>383.19</p>
                     </c>
                     <c ca="center">
                        <p>-1.5</p>
                     </c>
                     <c ca="center">
                        <p>0.0083</p>
                     </c>
                     <c ca="center">
                        <p>56</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>LOC310177</p>
                     </c>
                     <c ca="left">
                        <p>Similar to RIKEN cDNA 0610040D20</p>
                     </c>
                     <c ca="center">
                        <p>XM_226872.2</p>
                     </c>
                     <c ca="center">
                        <p>85.32</p>
                     </c>
                     <c ca="center">
                        <p>58.03</p>
                     </c>
                     <c ca="center">
                        <p>-1.5</p>
                     </c>
                     <c ca="center">
                        <p>0.0044</p>
                     </c>
                     <c ca="center">
                        <p>29</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>LOC297821</p>
                     </c>
                     <c ca="left">
                        <p>Similar to F23N19.9 (predicted)</p>
                     </c>
                     <c ca="center">
                        <p>XM_232684.3</p>
                     </c>
                     <c ca="center">
                        <p>1680.52</p>
                     </c>
                     <c ca="center">
                        <p>1185.76</p>
                     </c>
                     <c ca="center">
                        <p>-1.4</p>
                     </c>
                     <c ca="center">
                        <p>0.0052</p>
                     </c>
                     <c ca="center">
                        <p>36</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>LOC308443</p>
                     </c>
                     <c ca="left">
                        <p>Similar to CDNA sequence BC028440</p>
                     </c>
                     <c ca="center">
                        <p>XM_218345.2</p>
                     </c>
                     <c ca="center">
                        <p>426.63</p>
                     </c>
                     <c ca="center">
                        <p>301.59</p>
                     </c>
                     <c ca="center">
                        <p>-1.4</p>
                     </c>
                     <c ca="center">
                        <p>0.0059</p>
                     </c>
                     <c ca="center">
                        <p>41</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Anp32b</p>
                     </c>
                     <c ca="left">
                        <p>Acidic nuclear phosphoprotein 32 family, member B</p>
                     </c>
                     <c ca="center">
                        <p>NM_131911.2</p>
                     </c>
                     <c ca="center">
                        <p>454.58</p>
                     </c>
                     <c ca="center">
                        <p>323.06</p>
                     </c>
                     <c ca="center">
                        <p>-1.4</p>
                     </c>
                     <c ca="center">
                        <p>0.0082</p>
                     </c>
                     <c ca="center">
                        <p>55</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Ranbp6_predicted</p>
                     </c>
                     <c ca="left">
                        <p>RAN binding protein 6 (predicted)</p>
                     </c>
                     <c ca="center">
                        <p>XM_219796.2</p>
                     </c>
                     <c ca="center">
                        <p>309.74</p>
                     </c>
                     <c ca="center">
                        <p>222.79</p>
                     </c>
                     <c ca="center">
                        <p>-1.4</p>
                     </c>
                     <c ca="center">
                        <p>0.0031</p>
                     </c>
                     <c ca="center">
                        <p>22</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>LOC297903</p>
                     </c>
                     <c ca="left">
                        <p>Similar to RIKEN cDNA 6720467C03 (predicted)</p>
                     </c>
                     <c ca="center">
                        <p>XM_216357.3</p>
                     </c>
                     <c ca="center">
                        <p>1493.92</p>
                     </c>
                     <c ca="center">
                        <p>1088.11</p>
                     </c>
                     <c ca="center">
                        <p>-1.4</p>
                     </c>
                     <c ca="center">
                        <p>0.0075</p>
                     </c>
                     <c ca="center">
                        <p>50</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Qdpr</p>
                     </c>
                     <c ca="left">
                        <p>Quinoid dihydropteridine reductase</p>
                     </c>
                     <c ca="center">
                        <p>NM_022390.1</p>
                     </c>
                     <c ca="center">
                        <p>983.32</p>
                     </c>
                     <c ca="center">
                        <p>728.72</p>
                     </c>
                     <c ca="center">
                        <p>-1.3</p>
                     </c>
                     <c ca="center">
                        <p>0.0045</p>
                     </c>
                     <c ca="center">
                        <p>33</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Rnf134_predicted</p>
                     </c>
                     <c ca="left">
                        <p>Ring finger protein 134 (predicted)</p>
                     </c>
                     <c ca="center">
                        <p>XM_219963.3</p>
                     </c>
                     <c ca="center">
                        <p>952.04</p>
                     </c>
                     <c ca="center">
                        <p>717.85</p>
                     </c>
                     <c ca="center">
                        <p>-1.3</p>
                     </c>
                     <c ca="center">
                        <p>0.0059</p>
                     </c>
                     <c ca="center">
                        <p>42</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>LOC316731</p>
                     </c>
                     <c ca="left">
                        <p>Similar to hypothetical protein FLJ23017 (predicted)</p>
                     </c>
                     <c ca="center">
                        <p>XM_237515.3</p>
                     </c>
                     <c ca="center">
                        <p>74.86</p>
                     </c>
                     <c ca="center">
                        <p>58.48</p>
                     </c>
                     <c ca="center">
                        <p>-1.3</p>
                     </c>
                     <c ca="center">
                        <p>0.0094</p>
                     </c>
                     <c ca="center">
                        <p>65</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>LOC309197</p>
                     </c>
                     <c ca="left">
                        <p>Similar to hypothetical protein</p>
                     </c>
                     <c ca="center">
                        <p>XM_219560.3</p>
                     </c>
                     <c ca="center">
                        <p>1413.35</p>
                     </c>
                     <c ca="center">
                        <p>1112.64</p>
                     </c>
                     <c ca="center">
                        <p>-1.3</p>
                     </c>
                     <c ca="center">
                        <p>0.0050</p>
                     </c>
                     <c ca="center">
                        <p>35</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>LOC316732</p>
                     </c>
                     <c ca="left">
                        <p>Similar to RIKEN cDNA 4931400A14 (predicted)</p>
                     </c>
                     <c ca="center">
                        <p>XM_244261.3</p>
                     </c>
                     <c ca="center">
                        <p>251.40</p>
                     </c>
                     <c ca="center">
                        <p>201.41</p>
                     </c>
                     <c ca="center">
                        <p>-1.2</p>
                     </c>
                     <c ca="center">
                        <p>0.0062</p>
                     </c>
                     <c ca="center">
                        <p>45</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Bin2_predicted</p>
                     </c>
                     <c ca="left">
                        <p>Bridging integrator 2 (predicted)</p>
                     </c>
                     <c ca="center">
                        <p>XM_578696.1</p>
                     </c>
                     <c ca="center">
                        <p>57.42</p>
                     </c>
                     <c ca="center">
                        <p>47.13</p>
                     </c>
                     <c ca="center">
                        <p>-1.2</p>
                     </c>
                     <c ca="center">
                        <p>0.0076</p>
                     </c>
                     <c ca="center">
                        <p>51</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p><sup>a</sup>Estrogen; ER, estrogen-induced, or estrogen-receptor signaling or degradation are marked in bold. <sup>b</sup>t test. <sup>c</sup>Order (logistic regression) in the list of 66 genes differentially expressed between DA and DA.F344(Cia5d). <sup>d</sup>Cancer and invasion associated genes are in italics. <sup>e</sup>Differentially expressed in prostate, breast, colon or pharyngeal cancers. <sup>f</sup>Known to induce transcription or activation of gelatinases.</p>
               </tblfn>
            </tbl>
            <tbl id="T3">
               <title>
                  <p>Table 3</p>
               </title>
               <caption>
                  <p>Genes with increased expression in synovial fibroblasts from DA.F344 (Cia5d) compared with DA</p>
               </caption>
               <tblbdy cols="8">
                  <r>
                     <c ca="center">
                        <p>
                           <b>Gene Symbol<sup>d</sup></b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Definition<sup>a</sup></b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Accession number</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>DA mean</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Cia5d mean</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Fold change</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>P value<sup>b</sup></b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Overall rank<sup>c</sup></b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="8">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c cspan="8" ca="left">
                        <p>
                           <b>Cancer, Cell Cycle, DNA replication, recombination and repair</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>
                              <it>Gadd45b</it>
                           </b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Growth arrest and DNA-damage-inducible 45 beta </b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>NM_001008321.1</p>
                     </c>
                     <c ca="center">
                        <p>214.12</p>
                     </c>
                     <c ca="center">
                        <p>412.97</p>
                     </c>
                     <c ca="center">
                        <p>1.9</p>
                     </c>
                     <c ca="center">
                        <p>0.00572</p>
                     </c>
                     <c ca="center">
                        <p>39</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>
                              <it>Gmfg</it>
                           </b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Glia maturation factor, gamma (Gmfg)</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>NM_181091.2</p>
                     </c>
                     <c ca="center">
                        <p>1359.39</p>
                     </c>
                     <c ca="center">
                        <p>2261.87</p>
                     </c>
                     <c ca="center">
                        <p>1.7</p>
                     </c>
                     <c ca="center">
                        <p>0.00817</p>
                     </c>
                     <c ca="center">
                        <p>54</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Plekhg2_predicted</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Pleckstrin homology domain containing, family G (with RhoGef domain) member 2 (predicted)</p>
                     </c>
                     <c ca="center">
                        <p>XM_214862.3</p>
                     </c>
                     <c ca="center">
                        <p>91.97</p>
                     </c>
                     <c ca="center">
                        <p>147.62</p>
                     </c>
                     <c ca="center">
                        <p>1.6</p>
                     </c>
                     <c ca="center">
                        <p>0.00784</p>
                     </c>
                     <c ca="center">
                        <p>52</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Lox</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Lysyl oxidase</p>
                     </c>
                     <c ca="center">
                        <p>XM_579391.1</p>
                     </c>
                     <c ca="center">
                        <p>15755.11</p>
                     </c>
                     <c ca="center">
                        <p>24559.79</p>
                     </c>
                     <c ca="center">
                        <p>1.6</p>
                     </c>
                     <c ca="center">
                        <p>0.00198</p>
                     </c>
                     <c ca="center">
                        <p>12</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Brwd3_predicted</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Similar to bromo domain-containing protein disrupted in leukemia (LOC317213)</p>
                     </c>
                     <c ca="center">
                        <p>XM_228518.3</p>
                     </c>
                     <c ca="center">
                        <p>43.85</p>
                     </c>
                     <c ca="center">
                        <p>52.99</p>
                     </c>
                     <c ca="center">
                        <p>1.2</p>
                     </c>
                     <c ca="center">
                        <p>0.00596</p>
                     </c>
                     <c ca="center">
                        <p>43</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Aph1a</it>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Similar to anterior pharynx defective 1 homolog A (C. elegans)</p>
                     </c>
                     <c ca="center">
                        <p>XM_345251.2</p>
                     </c>
                     <c ca="center">
                        <p>2820.66</p>
                     </c>
                     <c ca="center">
                        <p>3246.28</p>
                     </c>
                     <c ca="center">
                        <p>1.2</p>
                     </c>
                     <c ca="center">
                        <p>0.00046</p>
                     </c>
                     <c ca="center">
                        <p>4</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <it>Pex19_predicted</it>
                           <sup>e</sup>
                        </p>
                     </c>
                     <c ca="left">
                        <p>Peroxisome biogenesis factor 19 (predicted)</p>
                     </c>
                     <c ca="center">
                        <p>XM_225711.3</p>
                     </c>
                     <c ca="center">
                        <p>119.41</p>
                     </c>
                     <c ca="center">
                        <p>135.98</p>
                     </c>
                     <c ca="center">
                        <p>1.1</p>
                     </c>
                     <c ca="center">
                        <p>0.00561</p>
                     </c>
                     <c ca="center">
                        <p>38</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Cell Signaling</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Fkbp7_predicted</p>
                     </c>
                     <c ca="left">
                        <p>FK506 binding protein 7 (predicted)</p>
                     </c>
                     <c ca="center">
                        <p>XM_215758.3</p>
                     </c>
                     <c ca="center">
                        <p>784.02</p>
                     </c>
                     <c ca="center">
                        <p>1450.53</p>
                     </c>
                     <c ca="center">
                        <p>1.9</p>
                     </c>
                     <c ca="center">
                        <p>0.00578</p>
                     </c>
                     <c ca="center">
                        <p>40</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Ncor1</b>
                        </p>
                     </c>
                     <c ca="left">
                        <p>
                           <b>Nuclear receptor co-repressor 1</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>XM_577103.1</p>
                     </c>
                     <c ca="center">
                        <p>420.35</p>
                     </c>
                     <c ca="center">
                        <p>679.65</p>
                     </c>
                     <c ca="center">
                        <p>1.6</p>
                     </c>
                     <c ca="center">
                        <p>0.00454</p>
                     </c>
                     <c ca="center">
                        <p>32</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Tap1</p>
                     </c>
                     <c ca="left">
                        <p>Transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)</p>
                     </c>
                     <c ca="center">
                        <p>NM_032055.1</p>
                     </c>
                     <c ca="center">
                        <p>190.32</p>
                     </c>
                     <c ca="center">
                        <p>288.49</p>
                     </c>
                     <c ca="center">
                        <p>1.5</p>
                     </c>
                     <c ca="center">
                        <p>0.00878</p>
                     </c>
                     <c ca="center">
                        <p>61</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Prnp</p>
                     </c>
                     <c ca="left">
                        <p>Prion protein</p>
                     </c>
                     <c ca="center">
                        <p>XM_579340.1</p>
                     </c>
                     <c ca="center">
                        <p>17242.89</p>
                     </c>
                     <c ca="center">
                        <p>24050.29</p>
                     </c>
                     <c ca="center">
                        <p>1.4</p>
                     </c>
                     <c ca="center">
                        <p>0.00029</p>
                     </c>
                     <c ca="center">
                        <p>3</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Fzd4</p>
                     </c>
                     <c ca="left">
                        <p>Frizzled homolog 4 (Drosophila)</p>
                     </c>
                     <c ca="center">
                        <p>NM_022623.1</p>
                     </c>
                     <c ca="center">
                        <p>44.45</p>
                     </c>
                     <c ca="center">
                        <p>60.14</p>
                     </c>
                     <c ca="center">
                        <p>1.4</p>
                     </c>
                     <c ca="center">
                        <p>0.00406</p>
                     </c>
                     <c ca="center">
                        <p>26</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Gene expression</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>H1f0</p>
                     </c>
                     <c ca="left">
                        <p>H1 histone family, member 0</p>
                     </c>
                     <c ca="center">
                        <p>NM_012578.2</p>
                     </c>
                     <c ca="center">
                        <p>150.12</p>
                     </c>
                     <c ca="center">
                        <p>229.40</p>
                     </c>
                     <c ca="center">
                        <p>1.5</p>
                     </c>
                     <c ca="center">
                        <p>0.00707</p>
                     </c>
                     <c ca="center">
                        <p>47</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Cell-Cell Interaction</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Fath</p>
                     </c>
                     <c ca="left">
                        <p>Hypothetical gene supported by NM_031819; Fath fat tumor suppressor homolog (Drosophila)</p>
                     </c>
                     <c ca="center">
                        <p>XM_579538.1</p>
                     </c>
                     <c ca="center">
                        <p>3803.04</p>
                     </c>
                     <c ca="center">
                        <p>5806.86</p>
                     </c>
                     <c ca="center">
                        <p>1.5</p>
                     </c>
                     <c ca="center">
                        <p>0.00206</p>
                     </c>
                     <c ca="center">
                        <p>13</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Extracellular Matrix</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Col5a1</p>
                     </c>
                     <c ca="left">
                        <p>Collagen, type V, alpha 1 (Col5a1)</p>
                     </c>
                     <c ca="center">
                        <p>NM_134452.1</p>
                     </c>
                     <c ca="center">
                        <p>7240.26</p>
                     </c>
                     <c ca="center">
                        <p>9852.22</p>
                     </c>
                     <c ca="center">
                        <p>1.4</p>
                     </c>
                     <c ca="center">
                        <p>0.00807</p>
                     </c>
                     <c ca="center">
                        <p>53</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Others</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Gtlf3b_predicted</p>
                     </c>
                     <c ca="left">
                        <p>Gene trap locus F3b (predicted)</p>
                     </c>
                     <c ca="center">
                        <p>XM_343907.2</p>
                     </c>
                     <c ca="center">
                        <p>78.16</p>
                     </c>
                     <c ca="center">
                        <p>175.41</p>
                     </c>
                     <c ca="center">
                        <p>2.2</p>
                     </c>
                     <c ca="center">
                        <p>0.00003</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Olfml2b_predicted</p>
                     </c>
                     <c ca="left">
                        <p>Olfactomedin-like 2B (predicted)</p>
                     </c>
                     <c ca="center">
                        <p>XM_222868.3</p>
                     </c>
                     <c ca="center">
                        <p>1336.30</p>
                     </c>
                     <c ca="center">
                        <p>2949.43</p>
                     </c>
                     <c ca="center">
                        <p>2.2</p>
                     </c>
                     <c ca="center">
                        <p>0.00241</p>
                     </c>
                     <c ca="center">
                        <p>17</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Gsdmdc1_predicted</p>
                     </c>
                     <c ca="left">
                        <p>Gasdermin domain containing 1 (predicted)</p>
                     </c>
                     <c ca="center">
                        <p>XM_235434.3</p>
                     </c>
                     <c ca="center">
                        <p>458.74</p>
                     </c>
                     <c ca="center">
                        <p>831.39</p>
                     </c>
                     <c ca="center">
                        <p>1.8</p>
                     </c>
                     <c ca="center">
                        <p>0.00295</p>
                     </c>
                     <c ca="center">
                        <p>20</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Trim41_predicted</p>
                     </c>
                     <c ca="left">
                        <p>Tripartite motif-containing 41 (predicted)</p>
                     </c>
                     <c ca="center">
                        <p>XM_220357.3</p>
                     </c>
                     <c ca="center">
                        <p>422.66</p>
                     </c>
                     <c ca="center">
                        <p>732.37</p>
                     </c>
                     <c ca="center">
                        <p>1.7</p>
                     </c>
                     <c ca="center">
                        <p>0.00100</p>
                     </c>
                     <c ca="center">
                        <p>7</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>LOC498815</p>
                     </c>
                     <c ca="left">
                        <p>Hypothetical gene supported by AY771707</p>
                     </c>
                     <c ca="center">
                        <p>XM_579873.1</p>
                     </c>
                     <c ca="center">
                        <p>243.56</p>
                     </c>
                     <c ca="center">
                        <p>366.68</p>
                     </c>
                     <c ca="center">
                        <p>1.5</p>
                     </c>
                     <c ca="center">
                        <p>0.00281</p>
                     </c>
                     <c ca="center">
                        <p>19</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>LOC304860</p>
                     </c>
                     <c ca="left">
                        <p>Similar to N-acetylneuraminate pyruvate lyase</p>
                     </c>
                     <c ca="center">
                        <p>XM_222736.3</p>
                     </c>
                     <c ca="center">
                        <p>270.64</p>
                     </c>
                     <c ca="center">
                        <p>401.65</p>
                     </c>
                     <c ca="center">
                        <p>1.5</p>
                     </c>
                     <c ca="center">
                        <p>0.00176</p>
                     </c>
                     <c ca="center">
                        <p>11</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Setdb2_predicted</p>
                     </c>
                     <c ca="left">
                        <p>SET domain, bifurcated 2 (predicted)</p>
                     </c>
                     <c ca="center">
                        <p>XM_224248.3</p>
                     </c>
                     <c ca="center">
                        <p>94.38</p>
                     </c>
                     <c ca="center">
                        <p>136.31</p>
                     </c>
                     <c ca="center">
                        <p>1.4</p>
                     </c>
                     <c ca="center">
                        <p>0.00945</p>
                     </c>
                     <c ca="center">
                        <p>66</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>LOC361448</p>
                     </c>
                     <c ca="left">
                        <p>Similar to cDNA sequence BC013529 (predicted)</p>
                     </c>
                     <c ca="center">
                        <p>XM_341726.2</p>
                     </c>
                     <c ca="center">
                        <p>2852.12</p>
                     </c>
                     <c ca="center">
                        <p>4043.46</p>
                     </c>
                     <c ca="center">
                        <p>1.4</p>
                     </c>
                     <c ca="center">
                        <p>0.00071</p>
                     </c>
                     <c ca="center">
                        <p>5</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>LOC360899</p>
                     </c>
                     <c ca="left">
                        <p>Similar to SERTA domain containing 4</p>
                     </c>
                     <c ca="center">
                        <p>XM_341174.2</p>
                     </c>
                     <c ca="center">
                        <p>1771.29</p>
                     </c>
                     <c ca="center">
                        <p>2489.20</p>
                     </c>
                     <c ca="center">
                        <p>1.4</p>
                     </c>
                     <c ca="center">
                        <p>0.00886</p>
                     </c>
                     <c ca="center">
                        <p>63</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Ormdl2_predicted</p>
                     </c>
                     <c ca="left">
                        <p>ORM1-like 2 (S. cerevisiae) (predicted)</p>
                     </c>
                     <c ca="center">
                        <p>XM_213832.3</p>
                     </c>
                     <c ca="center">
                        <p>1996.56</p>
                     </c>
                     <c ca="center">
                        <p>2773.15</p>
                     </c>
                     <c ca="center">
                        <p>1.4</p>
                     </c>
                     <c ca="center">
                        <p>0.00549</p>
                     </c>
                     <c ca="center">
                        <p>37</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>LOC498067</p>
                     </c>
                     <c ca="left">
                        <p>Similar to RIKEN cDNA 2310003P10 (LOC498067), mRNA.</p>
                     </c>
                     <c ca="center">
                        <p>XM_573266.1</p>
                     </c>
                     <c ca="center">
                        <p>368.00</p>
                     </c>
                     <c ca="center">
                        <p>494.10</p>
                     </c>
                     <c ca="center">
                        <p>1.3</p>
                     </c>
                     <c ca="center">
                        <p>0.00860</p>
                     </c>
                     <c ca="center">
                        <p>58</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Nit1</p>
                     </c>
                     <c ca="left">
                        <p>Nitrilase 1</p>
                     </c>
                     <c ca="center">
                        <p>NM_182668.1</p>
                     </c>
                     <c ca="center">
                        <p>3397.58</p>
                     </c>
                     <c ca="center">
                        <p>4472.84</p>
                     </c>
                     <c ca="center">
                        <p>1.3</p>
                     </c>
                     <c ca="center">
                        <p>0.00296</p>
                     </c>
                     <c ca="center">
                        <p>21</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Fam18b_predicted</p>
                     </c>
                     <c ca="left">
                        <p>Family with sequence similarity 18, member B (predicted)</p>
                     </c>
                     <c ca="center">
                        <p>XM_219680.3</p>
                     </c>
                     <c ca="center">
                        <p>2915.92</p>
                     </c>
                     <c ca="center">
                        <p>3746.20</p>
                     </c>
                     <c ca="center">
                        <p>1.3</p>
                     </c>
                     <c ca="center">
                        <p>0.00447</p>
                     </c>
                     <c ca="center">
                        <p>31</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Ubxd2_predicted</p>
                     </c>
                     <c ca="left">
                        <p>UBX domain containing 2 (predicted)</p>
                     </c>
                     <c ca="center">
                        <p>XM_573443.1</p>
                     </c>
                     <c ca="center">
                        <p>2018.75</p>
                     </c>
                     <c ca="center">
                        <p>2569.23</p>
                     </c>
                     <c ca="center">
                        <p>1.3</p>
                     </c>
                     <c ca="center">
                        <p>0.00411</p>
                     </c>
                     <c ca="center">
                        <p>27</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p><sup>a</sup>Estrogen; ER, estrogen-induced, or estrogen-receptor signaling or degradation are marked in bold. <sup>b</sup>t test. <sup>c</sup>Order (logistic regression) in the list of 66 genes differentially expressed between DA and DA.F344(Cia5d). <sup>d</sup>Cancer and invasion associated genes are in italics. <sup>e</sup>Increased expression in invading breast cancers.</p>
               </tblfn>
            </tbl>
            <fig id="F2">
               <title>
                  <p>Figure 2</p>
               </title>
               <caption>
                  <p>Cluster analysis and heat map of 66 differentially expressed genes</p>
               </caption>
               <text>
                  <p>Cluster analysis and heat map of 66 differentially expressed genes. DA and DA.F344(Cia5d) samples are clustered on columns and genes on rows. Bars on the left side of the figure identify the three clusters of genes with reduced expression (green) and the three clusters of genes with increased expression (red) in DA compared with DA.F344(Cia5d).</p>
               </text>
               <graphic file="ar2476-2"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>Genes upregulated in the highly invasive DA FLSs and downregulated in DA.F344(Cia5d) include cancer-associated and invasion regulatory genes</p>
            </st>
            <p>Cluster analysis identified three main clusters among the genes expressed in increased levels in DA (Figure <figr fid="F2">2</figr>). One of the three clusters contained eight genes, three of which have been implicated in cancer and cancer-related cellular phenotypes such as invasion, and included <it>Cxcl10</it>, <it>Vil2 </it>and <it>Dnmbp </it>(Figure <figr fid="F3">3</figr>). The other genes in this cluster are involved in ion transport (<it>Trpv2</it>), mitosis (<it>Smc1L1</it>), or have incompletely characterized functions (<it>Trim16</it>, <it>Ranbp6 </it>and <it>Hnrpul2</it>). In total, 12 out of the 36 genes (33.3%) expressed in increased levels by DA FLSs and downregulated in DA.F344(Cia5d) are known to regulate cancer-associated processes, including cell cycle progression (<it>Rpa2 </it>and <it>Rpa3</it>), cell invasion (<it>Cxcl10</it>, <it>Vil2</it>, <it>Nras</it>, and <it>Dnmbp</it>), and metastasis (<it>Vil2 </it>and <it>Brms1l</it>), respectively (Table <tblr tid="T2">2</tblr>). In fact, <it>Cxcl10 </it>was the second best discriminator between DA and DA.F344(Cia5d) cell lines, as per logistic regression (Table <tblr tid="T2">2</tblr>).</p>
            <fig id="F3">
               <title>
                  <p>Figure 3</p>
               </title>
               <caption>
                  <p>Cluster containing invasion and cancer-associated genes</p>
               </caption>
               <text>
                  <p>Cluster containing invasion and cancer-associated genes. Detailed view of the cluster that contains genes implicated in invasion and other cancer-associated phenotypes, including <it>Cxcl10, Vil2 </it>and <it>Dnmbp</it>.</p>
               </text>
               <graphic file="ar2476-3"/>
            </fig>
            <p>Of additional interest in relation to the MMP-2-dependent difference in FLS invasion that we have observed, three of these genes &#8211; namely <it>Cxcl10</it>, <it>Vil2 </it>and <it>Nras </it>&#8211; are known to regulate the synthesis or activation of gelatinases. Increased levels of <it>Cxcl10</it>, <it>Vil2</it>, <it>Dnmbp</it>, <it>Trim16</it>, and <it>Trpv2 </it>in DA were confirmed using quantitative real-time PCR, with most of these genes having a nearly fourfold or greater difference in expression (<it>P </it>&lt; 0.05; Figure <figr fid="F4">4a</figr>).</p>
            <fig id="F4">
               <title>
                  <p>Figure 4</p>
               </title>
               <caption>
                  <p>Quantitative real-time PCR</p>
               </caption>
               <text>
                  <p>Quantitative real-time PCR. Presented are quantitative real-time PCR analysis of <b>(a) </b>genes upregulated in DA and downregulated in DA.F344(Cia5d), and <b>(b) </b>genes downregulated in DA and upregulated in DA.F344(Cia5d). These include invasion and cancer-associated genes and estrogen-inducible genes. Estrogen receptors <it>Esr1 </it>and <it>Esr2 </it>were also analyzed. *<it>P </it>&lt; 0.05, <sup>#</sup><it>P </it>&lt; 0.07.</p>
               </text>
               <graphic file="ar2476-4"/>
            </fig>
         </sec>
         <sec>
            <st>
               <p>Genes downregulated in the highly invasive DA FLSs and upregulated in DA.F344(Cia5d) include tumor suppressor and cell cycle check-point genes</p>
            </st>
            <p>The list of genes with reduced expression in DA, as compared with increased expression in DA.F344(Cia5d) congenics, included seven genes that are involved in tumor suppression-like activity and cell cycle check-points, such as <it>Aph1a</it>, <it>Brwd3</it>, <it>Gadd45b</it>, <it>Gmfg</it>, <it>Lox</it>, and <it>Plekhg2 </it>(Table <tblr tid="T3">3</tblr>). <it>Gadd45b </it>was chosen for quantitative real-time PCR confirmation (<it>P </it>&lt; 0.05; Figure <figr fid="F4">4b</figr>). These observations, combined with the 11 cancer and invasion associated genes upregulated in DA, suggest an invasion-favoring profile similar to that described in cancer cells, characterized by reduced expression cell cycle check-point and tumor suppressor genes combined with increased expression of invasion genes.</p>
         </sec>
         <sec>
            <st>
               <p>Additional genes with reduced expression in DA FLSs</p>
            </st>
            <p>Additionally, <it>Ubxd2</it>, <it>Fzd4</it>, <it>Fkbp7</it>, <it>Olfml2b</it>, <it>Gsdmdc1 </it>and the transcriptional co-repressor <it>Ncor1 </it>were among the genes downregulated in DA and with increased expression in DA.F344(Cia5d). <it>Gtlf3b </it>(predicted), a gene trap fragment with unknown function, was among the most significantly differentially expressed genes (<it>P </it>= 0.000025; 2.2-fold difference; Table <tblr tid="T3">3</tblr>). The greater than twofold difference in expression of <it>Olfml2b </it>and <it>Gsdmdc1 </it>was confirmed with quantitative real-time PCR (Figure <figr fid="F4">4b</figr>).</p>
         </sec>
         <sec>
            <st>
               <p>Increased number of estrogen-inducible and ER signaling regulatory genes among the differentially expressed genes</p>
            </st>
            <p>Nine genes or 13.6% of the 66 differentially expressed genes were either estrogen-inducible genes, such as <it>Cxcl10</it>, <it>Vil2</it>, <it>Trim16</it>, <it>Gins3 </it>(predicted), and <it>Gadd45b</it>, or genes involved in modulating the estrogen receptor (ER) signaling such as <it>Stub1 </it>and <it>Stip1</it>. <it>Ncor1 </it>negatively regulates ER-mediated transcription and its levels were also reduced in DA, further suggesting unopposed ER-mediated transcription. The differential expression of <it>Cxcl10</it>, <it>Vil2</it>, <it>Trim16</it>, <it>Gins3</it>, and <it>Gadd45b </it>was confirmed with quantitative real-time PCR (Figure <figr fid="F4">4a, b</figr>). The ERs <it>Esr1 </it>and <it>Esr2 </it>were not differentially expressed in the microarray analysis, and those results were confirmed with quantitative real-time PCR (Figure <figr fid="F4">4b</figr>). There was a trend toward increased expression <it>Esr2 </it>in DA.F344(Cia5d), but that difference did not reach statistical significance (<it>P </it>= 0.093; Figure <figr fid="F4">4b</figr>). Taken together, this pattern of gene expression suggests that the invasive DA FLSs have an enhanced ER activity regulated at different levels that could include reduced degradation of the ER, reduced inhibition of the ER-mediated transcription, and increased levels of estrogen-inducible genes.</p>
         </sec>
         <sec>
            <st>
               <p>Five of the differentially expressed genes are located within the Cia5d interval</p>
            </st>
            <p>Five out of the 66 differentially expressed genes were located within the <it>Cia5d </it>interval (Table <tblr tid="T4">4</tblr>). The number of genes located within the <it>Cia5d </it>interval found to be differentially expressed between DA and DA.F344(Cia5d) FLSs was greater than would be expected by chance (3.3% observed versus 0.8% expected by chance; <it>P </it>= 0.0044 by &#967;<sup>2 </sup>with Yates correction; Table <tblr tid="T5">5</tblr>).</p>
            <tbl id="T4">
               <title>
                  <p>Table 4</p>
               </title>
               <caption>
                  <p>Differentially expressed genes located within the Cia5d interval on rat chromosome 10</p>
               </caption>
               <tblbdy cols="10">
                  <r>
                     <c ca="center">
                        <p>
                           <b>Symbol</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Definition</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Accession number</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Position (Mb)</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Cytogenetic</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>DA mean</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Cia5d mean</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Fold change</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>t test</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Overall rank</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="10">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Reduced levels in Cia5d</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Trim16</p>
                     </c>
                     <c ca="left">
                        <p>Tripartite motif protein 16 (predicted) (Trim16_predicted)</p>
                     </c>
                     <c ca="center">
                        <p>XM_220552.3</p>
                     </c>
                     <c ca="center">
                        <p>48.95</p>
                     </c>
                     <c ca="center">
                        <p>10q23</p>
                     </c>
                     <c ca="center">
                        <p>262.14</p>
                     </c>
                     <c ca="center">
                        <p>82.27</p>
                     </c>
                     <c ca="center">
                        <p>-3.19</p>
                     </c>
                     <c ca="center">
                        <p>0.00326</p>
                     </c>
                     <c ca="center">
                        <p>23</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Trpv2</p>
                     </c>
                     <c ca="left">
                        <p>Transient receptor potential cation channel, subfamily V, member 2 (Trpv2)</p>
                     </c>
                     <c ca="center">
                        <p>NM_017207.1</p>
                     </c>
                     <c ca="center">
                        <p>48.76</p>
                     </c>
                     <c ca="center">
                        <p>10q23</p>
                     </c>
                     <c ca="center">
                        <p>177.90</p>
                     </c>
                     <c ca="center">
                        <p>92.25</p>
                     </c>
                     <c ca="center">
                        <p>-1.93</p>
                     </c>
                     <c ca="center">
                        <p>0.00745</p>
                     </c>
                     <c ca="center">
                        <p>49</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>
                           <b>Increased levels in Cia5d</b>
                        </p>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Ncor1</p>
                     </c>
                     <c ca="left">
                        <p>Nuclear receptor co-repressor 1 (Ncor1)</p>
                     </c>
                     <c ca="center">
                        <p>XM_577103.1</p>
                     </c>
                     <c ca="center">
                        <p>48.62</p>
                     </c>
                     <c ca="center">
                        <p>10q23</p>
                     </c>
                     <c ca="center">
                        <p>420.35</p>
                     </c>
                     <c ca="center">
                        <p>679.65</p>
                     </c>
                     <c ca="center">
                        <p>1.62</p>
                     </c>
                     <c ca="center">
                        <p>0.00454</p>
                     </c>
                     <c ca="center">
                        <p>32</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Gtlf3b</p>
                     </c>
                     <c ca="left">
                        <p>Gene trap locus F3b (predicted) (Gtlf3b_predicted)</p>
                     </c>
                     <c ca="center">
                        <p>XM_343907.2</p>
                     </c>
                     <c ca="center">
                        <p>47.05</p>
                     </c>
                     <c ca="center">
                        <p>10q22</p>
                     </c>
                     <c ca="center">
                        <p>78.16</p>
                     </c>
                     <c ca="center">
                        <p>175.41</p>
                     </c>
                     <c ca="center">
                        <p>2.24</p>
                     </c>
                     <c ca="center">
                        <p>0.00003</p>
                     </c>
                     <c ca="center">
                        <p>1</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Trim41</p>
                     </c>
                     <c ca="left">
                        <p>Tripartite motif-containing 41 (predicted)</p>
                     </c>
                     <c ca="center">
                        <p>XM_220357.3</p>
                     </c>
                     <c ca="center">
                        <p>34.08</p>
                     </c>
                     <c ca="center">
                        <p>10q21</p>
                     </c>
                     <c ca="center">
                        <p>422.65</p>
                     </c>
                     <c ca="center">
                        <p>732.37</p>
                     </c>
                     <c ca="center">
                        <p>1.73</p>
                     </c>
                     <c ca="center">
                        <p>0.00099</p>
                     </c>
                     <c ca="center">
                        <p>7</p>
                     </c>
                  </r>
               </tblbdy>
            </tbl>
            <tbl id="T5">
               <title>
                  <p>Table 5</p>
               </title>
               <caption>
                  <p>A greater than expected number of genes located within the Cia5d interval were differentially expressed in FLS<sup>a</sup></p>
               </caption>
               <tblbdy cols="3">
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Differentially expressed</b>
                        </p>
                     </c>
                     <c ca="center">
                        <p>
                           <b>Not-differentially expressed</b>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Genes located within Cia5d</p>
                     </c>
                     <c ca="center">
                        <p>5 (3.3%)</p>
                     </c>
                     <c ca="center">
                        <p>146</p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>Genes located outside Cia5d</p>
                     </c>
                     <c ca="center">
                        <p>61 (0.8%)</p>
                     </c>
                     <c ca="center">
                        <p>7453</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p><sup>a</sup>p-value = 0.00442 (Chi-square with Yates correction).</p>
               </tblfn>
            </tbl>
            <p><it>Trim16</it>, <it>Trpv2</it>, and <it>Ncor1 </it>are closely located on chromosome 10q23, raising the possibility that a polymorphism in a regulatory region or intron in this region, or even in one of these genes, could account for the difference in expression detected between the two strains.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Discussion</p>
         </st>
         <p>RA histology is typically characterized by pronounced synovial hyperplasia, also called 'pannus'. The RA pannus produces proinflammatory cytokines and proteases, and invades cartilage and bone leading to joint destruction and deformities <abbrgrp><abbr bid="B4">4</abbr></abbrgrp>. The FLS is a key player in RA pannus and joint pathology, and has increased invasive properties, compared with osteoarthritis, even after several passages <it>in vitro </it><abbrgrp><abbr bid="B12">12</abbr><abbr bid="B27">27</abbr></abbrgrp>. Furthermore, the increased invasive properties of RA FLSs have been associated with increased radiographic joint destruction <abbrgrp><abbr bid="B13">13</abbr></abbrgrp>, underscoring the relevance of this <it>in vitro </it>phenotype to disease outcome.</p>
         <p>We recently described the first evidence that the invasive properties of FLSs are genetically regulated <abbrgrp><abbr bid="B15">15</abbr></abbrgrp>. We determined that a gene located within the arthritis severity regulatory <it>Cia5d </it>interval specifically controls the invasive properties of FLSs via the regulation of the production of soluble MT1-MMP and activation of MMP-2 <abbrgrp><abbr bid="B15">15</abbr></abbrgrp>. Levels of active MMP-2 are also increased in the synovial fluid of patients with RA, and correlate with disease severity and radiographic damage <abbrgrp><abbr bid="B28">28</abbr></abbrgrp>. Therefore, understanding the regulation of cell invasion and MMP-2 activation is highly relevant to RA. In addition, several common cancers have increased levels of MMP-2, which correlates with worse prognosis <abbrgrp><abbr bid="B29">29</abbr><abbr bid="B30">30</abbr><abbr bid="B31">31</abbr><abbr bid="B32">32</abbr><abbr bid="B33">33</abbr><abbr bid="B34">34</abbr><abbr bid="B35">35</abbr><abbr bid="B36">36</abbr></abbrgrp>, suggesting that identifying the <it>Cia5d </it>gene and the pathways controlled by it could potentially generate novel targets relevant to cancer treatment as well.</p>
         <p>In the present study we used a novel strategy to identify differences in gene expression that correlate with the invasive properties of FLSs. First, two closely related strains were used. These strains have identical DA genomes, except that DA.F344(Cia5d) congenics have F344 arthritis-resistant alleles in a 37.2 megabase interval on chromosome 10. This strategy minimized noise related to allelic variations at other regions of the genome that are not related to the phenotype of interest. Second, instead of using synovial tissues, which have mixed cellularities that interfere with the interpretation of the results, we generate and used primary FLS cell lines. Third, FLSs from DA and DA.F344(Cia5d) differ in their invasive properties, thus providing a more precise phenotype. Finally, the cells used for RNA extractions were cultured on the same collagen matrix (Matrigel) used in the invasion experiments, hence recreating the same <it>in vitro </it>environment. This latter aspect is critical because extracellular matrix and cell influence processes that are central to cell invasion, such as the expression of adhesion molecules and MMP-2 activation <abbrgrp><abbr bid="B19">19</abbr></abbrgrp>, and are required for proper activation of the invasive phenotype, including gene transcription. This strategy led to the identification of new genes involved in FLS invasion.</p>
         <p>A genome-wide analysis of gene expression conducted with RA FLSs suggested two patterns that correlated with increased or reduced inflammation in the tissues of origin <abbrgrp><abbr bid="B37">37</abbr></abbrgrp>. Those RA FLSs were not studied for invasion, and there was no control group without erosive changes for comparison. Furthermore, the RNA was obtained from cells cultured on plastic dishes and not on a collagen matrix such as Matrigel. Therefore, it was not surprising that using different methodologies to address a different question we detected a new FLS invasion signature that is different from the two RA FLS gene expression patterns previously reported.</p>
         <p>A genome-wide microarray-based gene expression analysis was conducted to identify genes and pathways that are differentially expressed between highly invasive DA and minimally invasive DA.F344(Cia5d) FLSs. The analysis revealed that 66 genes out of the 7,665 genes expressed by FLSs were differentially expressed between DA and DA.F344(Cia5d) FLSs (<it>P </it>&lt; 0.01). Nineteen of the 66 differentially expressed genes (28.7%) had previously been implicated in tumor suppression activity or other cancer cell phenotypes, but had not been implicated in the invasive properties of the FLSs. These cancer-related phenotypes include malignant transformation (<it>Hnrpd</it>) <abbrgrp><abbr bid="B38">38</abbr></abbrgrp>, tumor growth (<it>Ach1a </it>and <it>Gfmg</it>) <abbrgrp><abbr bid="B39">39</abbr><abbr bid="B40">40</abbr></abbrgrp>, oncogene-like activity (<it>Plekgh2</it>) <abbrgrp><abbr bid="B41">41</abbr></abbrgrp>, tumor apoptosis (<it>Gadd45b</it>) <abbrgrp><abbr bid="B42">42</abbr></abbrgrp>, tumor suppressor activity (<it>Brwd3</it>) <abbrgrp><abbr bid="B43">43</abbr></abbrgrp>, cancer cell growth arrest (<it>Ube2d3</it>) <abbrgrp><abbr bid="B44">44</abbr></abbrgrp>, contact inhibition (<it>Gmfg</it>) <abbrgrp><abbr bid="B45">45</abbr></abbrgrp>, and cell invasion (<it>Lox, Ach1a</it>, <it>Cxcl10</it>, <it>Vil2</it>, and <it>Nras</it>) <abbrgrp><abbr bid="B46">46</abbr><abbr bid="B47">47</abbr><abbr bid="B48">48</abbr><abbr bid="B49">49</abbr><abbr bid="B50">50</abbr></abbrgrp>. Genetic variations in DNA synthesis gene <it>Rpa3 </it>have been associated with susceptibility to carcinomas <abbrgrp><abbr bid="B51">51</abbr></abbrgrp>, whereas increased cancer expression of <it>Rpa2 </it>is associated with adverse outcome in colon cancer <abbrgrp><abbr bid="B52">52</abbr></abbrgrp>. Some of these genes were found to be expressed in increased levels in certain cancers (<it>Hnrpd </it>and <it>Lsm8</it>) <abbrgrp><abbr bid="B53">53</abbr><abbr bid="B54">54</abbr></abbrgrp>, including highly invasive types <abbrgrp><abbr bid="B55">55</abbr></abbrgrp>. These observations suggest that FLSs derived from arthritis joints and cancer cells share common processes in the regulation of cell invasion, and that these processes are in part regulated by a gene located within the arthritis severity locus <it>Cia5d</it>.</p>
         <p><it>Nras </it><abbrgrp><abbr bid="B56">56</abbr><abbr bid="B57">57</abbr></abbrgrp>, <it>Vil2 </it>(encoding the ezrin protein) <abbrgrp><abbr bid="B49">49</abbr><abbr bid="B50">50</abbr></abbrgrp>, and <it>Cxcl10 </it><abbrgrp><abbr bid="B58">58</abbr></abbrgrp> &#8211; three genes that are upregulated in DA but downregulated in DA.F344(Cia5d) &#8211; have also been implicated in the regulation of gelatinases' expression and activation, including MMP-2 (Figure <figr fid="F5">5</figr>). These observations provide a direct link between the invasion and MMP-2 phenotypes that we have been studying and the gene expression signature regulated by the <it>Cia5d </it>locus. Furthermore, studies with RA synovial tissues <abbrgrp><abbr bid="B59">59</abbr><abbr bid="B60">60</abbr></abbrgrp> and RA FLSs <abbrgrp><abbr bid="B60">60</abbr></abbrgrp> have also demonstrated increased expression of <it>Cxcl10 </it>both at mRNA and protein levels. <it>Cxcl10 </it>has also been shown to increase the production and activity of gelatinases in RA FLSs <abbrgrp><abbr bid="B61">61</abbr></abbrgrp>, underscoring the direct relevance of our <it>in vitro </it>discoveries to human disease.</p>
         <fig id="F5">
            <title>
               <p>Figure 5</p>
            </title>
            <caption>
               <p>Known interactions between genes differentially expressed in FLSs from DA and DA</p>
            </caption>
            <text>
               <p>Known interactions between genes differentially expressed in FLSs from DA and DA.F344(Cia5d). Several estrogen (&#946;-estradiol)-regulated genes, including genes involved in increasing either the expression or activity of matrix metalloproteinase (MMP)-2, such as <it>Cxcl10</it>, <it>Nras</it>, and <it>Vil2 </it>were differentially expressed. Green indicates downregulated in DA.F344(Cia5d) and upregulated in DA. Red indicates upregulated in DA.F344(Cia5d) and downregulated in DA. White indicates that the gene is part of the pathway but was not differentially expressed in fibroblast-like synoviocytes (FLSs) from the two strains. Color intensity correlates with magnitude of the expression difference.</p>
            </text>
            <graphic file="ar2476-5"/>
         </fig>
         <p>In addition to the proinvasive and MMP-2 activating properties associated with <it>Cxcl10 </it>in FLSs, this chemokine can also attract C-X-C chemokine receptor (CXCR)3-expressing inflammatory cells such as memory T cells <abbrgrp><abbr bid="B62">62</abbr></abbrgrp> and mast cells <abbrgrp><abbr bid="B59">59</abbr></abbrgrp> into the joint, further contributing to disease severity. Indeed, recent studies that either targeted <it>Cxcl10 </it><abbrgrp><abbr bid="B63">63</abbr></abbrgrp> or its receptor CXCR3 <abbrgrp><abbr bid="B64">64</abbr></abbrgrp> significantly ameliorated arthritis in rodents.</p>
         <p><it>Cxcl10 </it><abbrgrp><abbr bid="B65">65</abbr></abbrgrp>, <it>Vil2 </it><abbrgrp><abbr bid="B66">66</abbr></abbrgrp>, and <it>Trim16 </it><abbrgrp><abbr bid="B67">67</abbr></abbrgrp> &#8211; three of the most significantly upregulated genes in DA &#8211; are known to be induced by estrogens (Figure <figr fid="F5">5</figr>). A complete analysis of all of the 66 differentially expressed genes revealed that nine of them (13.6%) were either regulated by estrogen (<it>Cxcl10</it>, <it>Vil2</it>, <it>Trim16</it>, <it>Gins3</it>, <it>Gadd45b</it>, and <it>Gmfg</it>) <abbrgrp><abbr bid="B68">68</abbr></abbrgrp> or are involved in ER signaling (<it>Stip1</it>), ER ubiquitination (<it>Stub1</it>), or ER-mediated transcription (<it>Ncor1</it>). These observations suggested that abnormalities in the regulation of ER signaling and ER-mediated transcription could contribute to the invasive properties of DA FLSs. Indeed, estrogens have been shown to increase levels of active MMP-2 in various tissues and cell types <abbrgrp><abbr bid="B69">69</abbr><abbr bid="B70">70</abbr><abbr bid="B71">71</abbr></abbrgrp>, including breast cancers <abbrgrp><abbr bid="B72">72</abbr></abbrgrp>, and estrogen antagonists reversed that effect <abbrgrp><abbr bid="B71">71</abbr><abbr bid="B73">73</abbr></abbrgrp>. Estrogens also increase the production of active MMP-2 and the <it>in vitro </it>invasive properties of RA FLSs <abbrgrp><abbr bid="B74">74</abbr></abbrgrp> (Figure <figr fid="F5">5</figr>). Although estrogens are typically thought of as having anti-inflammatory properties <abbrgrp><abbr bid="B75">75</abbr></abbrgrp>, our observations suggest an intrinsic dysregulation in ER signaling in DA FLSs. This dysregulation in ER is controlled by the <it>Cia5d </it>gene, and could contribute to increased FLS invasion and cartilage and bone erosive changes.</p>
         <p>Five of the differentially expressed genes were located within the <it>Cia5d </it>interval, and this number was greater than expected by chance. Three of these were upregulated in DA.F344(Cia5d) FLS (<it>Ncor1</it>, <it>Trim41</it>, and <it>Gtlf3b</it>) and two were downregulated in DA.F344(Cia5d) (<it>Trpv2 </it>and <it>Trim16</it>), raising the possibility that a polymorphism/mutation in one of these genes could explain the arthritis and FLS invasive phenotypes attributed to <it>Cia5d</it>. Specifically, a polymorphism in a regulatory element or intron in one of these genes, or in another gene in the region, could influence transcription, thus explaining differences in levels of mRNA and disease. This has been the case in studies of two other autoimmune or inflammatory diseases in which microarray analysis led to the identification of the disease-causing polymorphism <abbrgrp><abbr bid="B76">76</abbr><abbr bid="B77">77</abbr></abbrgrp>. In the present study only <it>Ncor1</it>, a transcriptional repressor regulated by estrogens, appears to be an interesting candidate. <it>Trpv2 </it>is a cation channel ubiquitously expressed, and the other three genes (<it>Trim16</it>, <it>Trim41</it>, and <it>Gtlf3b</it>) have less clear functions. The <it>Cia5d </it>interval contains more than 100 genes, and not all were present in the Illumina microarray. It would be premature to exclude these genes at this point, and additional studies with recombinant subcongenic strains are under way.</p>
      </sec>
      <sec>
         <st>
            <p>Conclusion</p>
         </st>
         <p>We have identified a novel invasion-associated gene expression signature and evidence suggesting a dysregulation in ER signaling in arthritis FLSs, which are regulated by the arthritis severity locus <it>Cia5d</it>. It is anticipated that the specific identification of the <it>Cia5d </it>gene, and the continued characterization of processes regulated by this gene, will generate new targets for therapeutic intervention aimed at reducing cartilage and bone destruction, and new prognostic markers for RA. The parallels between our findings in FLSs and observations from cancer studies suggest that the <it>Cia5d </it>gene might be important for cancer biology as well.</p>
      </sec>
      <sec>
         <st>
            <p>Abbreviations</p>
         </st>
         <p>CXCR: C-X-C chemokine receptor; DMEM: Dulbecco's modified Eagle's medium; ER: estrogen receptor; FLS: fibroblast-like synoviocyte; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; MMP: matrix metalloproteinase; MT1: membrane-type 1; PCR: polymerase chain reaction; RA: rheumatoid arthritis.</p>
      </sec>
      <sec>
         <st>
            <p>Competing interests</p>
         </st>
         <p>The authors declare that they have no competing interests.</p>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>All authors made substantial contributions to this study. TL generated the FLS cell lines and worked on the gene expression analyses. MB conducted the cellular and molecular biology experiments. WL worked on the gene expression statistical analysis. PSG designed the study and conducted the microarray gene expression analysis and pathway discovery, and wrote the manuscript. All authors read the manuscript critically, suggested modifications, and approved the final version.</p>
      </sec>
      <sec>
         <st>
            <p>Ackowledgments</p>
         </st>
         <p>This study was funded by National Institutes of Health grants R01-AR46213, R01-AR052439 (NIAMS), and R01-AI54348 (NIAID) to Dr P Gulko. The authors want to thank Franak Batliwalla and Aarti Damle, members of the Feinstein Institute's microarray core facility, for their assistance.</p>
      </sec>
   </bdy>
   <bm>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>Genetics of rheumatoid arthritis</p>
            </title>
            <aug>
               <au>
                  <snm>Gregersen</snm>
                  <fnm>PK</fnm>
               </au>
               <au>
                  <snm>Plenge</snm>
                  <fnm>RM</fnm>
               </au>
               <au>
                  <snm>Gulko</snm>
                  <fnm>PS</fnm>
               </au>
            </aug>
            <source>Rheumatoid Arthritis</source>
            <publisher>New York, NY: Oxford University Press</publisher>
            <editor>Firestein G, Panayi G, Wollheim FA</editor>
            <edition>2</edition>
            <pubdate>2006</pubdate>
            <fpage>3</fpage>
            <lpage>14</lpage>
         </bibl>
         <bibl id="B2">
            <title>
               <p>Matrix metalloproteinase 2 from human rheumatoid synovial fibroblasts. Purification and activation of the precursor and enzymic properties</p>
            </title>
            <aug>
               <au>
                  <snm>Okada</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Morodomi</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Enghild</snm>
                  <fnm>JJ</fnm>
               </au>
               <au>
                  <snm>Suzuki</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Yasui</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Nakanishi</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Salvesen</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Nagase</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Eur J Biochem</source>
            <pubdate>1990</pubdate>
            <volume>194</volume>
            <fpage>721</fpage>
            <lpage>730</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1432-1033.1990.tb19462.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">2269296</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>Matrix metalloproteinase-8 is expressed in rheumatoid synovial fibroblasts and endothelial cells. Regulation by tumor necrosis factor-alpha and doxycycline</p>
            </title>
            <aug>
               <au>
                  <snm>Hanemaaijer</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Sorsa</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Konttinen</snm>
                  <fnm>YT</fnm>
               </au>
               <au>
                  <snm>Ding</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Sutinen</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Visser</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>van Hinsbergh</snm>
                  <fnm>VW</fnm>
               </au>
               <au>
                  <snm>Helaakoski</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Kainulainen</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>R&#246;nk&#228;</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Tschesche</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Salo</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>1997</pubdate>
            <volume>272</volume>
            <fpage>31504</fpage>
            <lpage>31509</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1074/jbc.272.50.31504</pubid>
                  <pubid idtype="pmpid" link="fulltext">9395486</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>Rheumatoid arthritis</p>
            </title>
            <aug>
               <au>
                  <snm>Gulko</snm>
                  <fnm>PS</fnm>
               </au>
               <au>
                  <snm>Winchester</snm>
                  <fnm>RJ</fnm>
               </au>
            </aug>
            <source>Samter's Immunologic Diseases</source>
            <publisher>Baltimore, MD: Lippincott, Williams &amp; Wilkins</publisher>
            <editor>Austen KF, Frank MM, Atkinson JP, Cantor H</editor>
            <edition>6</edition>
            <pubdate>2001</pubdate>
            <volume>II</volume>
            <fpage>427</fpage>
            <lpage>463</lpage>
         </bibl>
         <bibl id="B5">
            <title>
               <p>Cadherin-11 in synovial lining formation and pathology in arthritis</p>
            </title>
            <aug>
               <au>
                  <snm>Lee</snm>
                  <fnm>DM</fnm>
               </au>
               <au>
                  <snm>Kiener</snm>
                  <fnm>HP</fnm>
               </au>
               <au>
                  <snm>Agarwal</snm>
                  <fnm>SK</fnm>
               </au>
               <au>
                  <snm>Noss</snm>
                  <fnm>EH</fnm>
               </au>
               <au>
                  <snm>Watts</snm>
                  <fnm>GF</fnm>
               </au>
               <au>
                  <snm>Chisaka</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Takeichi</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Brenner</snm>
                  <fnm>MB</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>2007</pubdate>
            <volume>315</volume>
            <fpage>1006</fpage>
            <lpage>1010</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1126/science.1137306</pubid>
                  <pubid idtype="pmpid" link="fulltext">17255475</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>Ligation of CD40 on fibroblasts induces CD54 (ICAM-1) and CD106 (VCAM-1) up-regulation and IL-6 production and proliferation</p>
            </title>
            <aug>
               <au>
                  <snm>Yellin</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Winikoff</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Fortune</snm>
                  <fnm>SM</fnm>
               </au>
               <au>
                  <snm>Baum</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Crow</snm>
                  <fnm>MK</fnm>
               </au>
               <au>
                  <snm>Lederman</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Chess</snm>
                  <fnm>L</fnm>
               </au>
            </aug>
            <source>J Leukoc Biol</source>
            <pubdate>1995</pubdate>
            <volume>58</volume>
            <fpage>209</fpage>
            <lpage>216</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">7543921</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>Transforming growth factor beta 1 (TGF-beta 1) induced neutrophil recruitment to synovial tissues: implications for TGF-beta-driven synovial inflammation and hyperplasia</p>
            </title>
            <aug>
               <au>
                  <snm>Fava</snm>
                  <fnm>RA</fnm>
               </au>
               <au>
                  <snm>Olsen</snm>
                  <fnm>NJ</fnm>
               </au>
               <au>
                  <snm>Postlethwaite</snm>
                  <fnm>AE</fnm>
               </au>
               <au>
                  <snm>Broadley</snm>
                  <fnm>KN</fnm>
               </au>
               <au>
                  <snm>Davidson</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Nanney</snm>
                  <fnm>LB</fnm>
               </au>
               <au>
                  <snm>Lucas</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Townes</snm>
                  <fnm>AS</fnm>
               </au>
            </aug>
            <source>J Exp Med</source>
            <pubdate>1991</pubdate>
            <volume>173</volume>
            <fpage>1121</fpage>
            <lpage>1132</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">2118851</pubid>
                  <pubid idtype="pmpid">2022923</pubid>
                  <pubid idtype="doi">10.1084/jem.173.5.1121</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>Anti-TNF-alpha antibody allows healing of joint damage in polyarthritic transgenic mice</p>
            </title>
            <aug>
               <au>
                  <snm>Shealy</snm>
                  <fnm>DJ</fnm>
               </au>
               <au>
                  <snm>Wooley</snm>
                  <fnm>PH</fnm>
               </au>
               <au>
                  <snm>Emmell</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Volk</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Rosenberg</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Treacy</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Wagner</snm>
                  <fnm>CL</fnm>
               </au>
               <au>
                  <snm>Mayton</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Griswold</snm>
                  <fnm>DE</fnm>
               </au>
               <au>
                  <snm>Song</snm>
                  <fnm>XY</fnm>
               </au>
            </aug>
            <source>Arthritis Res</source>
            <pubdate>2002</pubdate>
            <volume>4</volume>
            <fpage>R7</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">125301</pubid>
                  <pubid idtype="pmpid" link="fulltext">12223110</pubid>
                  <pubid idtype="doi">10.1186/ar430</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>Exacerbation of acute inflammatory arthritis by the colony-stimulating factors CSF-1 and granulocyte macrophage (GM)-CSF: evidence of macrophage infiltration and local proliferation</p>
            </title>
            <aug>
               <au>
                  <snm>Bischof</snm>
                  <fnm>RJ</fnm>
               </au>
               <au>
                  <snm>Zafiropoulos</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Hamilton</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Campbell</snm>
                  <fnm>IK</fnm>
               </au>
            </aug>
            <source>Clin Exp Immunol</source>
            <pubdate>2000</pubdate>
            <volume>119</volume>
            <fpage>361</fpage>
            <lpage>367</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1905504</pubid>
                  <pubid idtype="pmpid" link="fulltext">10632676</pubid>
                  <pubid idtype="doi">10.1046/j.1365-2249.2000.01125.x</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>NF-kappaB activation provides the potential link between inflammation and hyperplasia in the arthritic joint</p>
            </title>
            <aug>
               <au>
                  <snm>Miagkov</snm>
                  <fnm>AV</fnm>
               </au>
               <au>
                  <snm>Kovalenko</snm>
                  <fnm>DV</fnm>
               </au>
               <au>
                  <snm>Brown</snm>
                  <fnm>CE</fnm>
               </au>
               <au>
                  <snm>Didsbury</snm>
                  <fnm>JR</fnm>
               </au>
               <au>
                  <snm>Cogswell</snm>
                  <fnm>JP</fnm>
               </au>
               <au>
                  <snm>Stimpson</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Baldwin</snm>
                  <fnm>AS</fnm>
               </au>
               <au>
                  <snm>Makarov</snm>
                  <fnm>SS</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>1998</pubdate>
            <volume>95</volume>
            <fpage>13859</fpage>
            <lpage>13864</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">24931</pubid>
                  <pubid idtype="pmpid" link="fulltext">9811891</pubid>
                  <pubid idtype="doi">10.1073/pnas.95.23.13859</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>Decreased angiogenesis and arthritic disease in rabbits treated with an alphavbeta3 antagonist</p>
            </title>
            <aug>
               <au>
                  <snm>Storgard</snm>
                  <fnm>CM</fnm>
               </au>
               <au>
                  <snm>Stupack</snm>
                  <fnm>DG</fnm>
               </au>
               <au>
                  <snm>Jonczyk</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Goodman</snm>
                  <fnm>SL</fnm>
               </au>
               <au>
                  <snm>Fox</snm>
                  <fnm>RI</fnm>
               </au>
               <au>
                  <snm>Cheresh</snm>
                  <fnm>DA</fnm>
               </au>
            </aug>
            <source>J Clin Invest</source>
            <pubdate>1999</pubdate>
            <volume>103</volume>
            <fpage>47</fpage>
            <lpage>54</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">407856</pubid>
                  <pubid idtype="pmpid" link="fulltext">9884333</pubid>
                  <pubid idtype="doi">10.1172/JCI3756</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>Synovial fibroblasts of patients with rheumatoid arthritis attach to and invade normal human cartilage when engrafted into SCID mice</p>
            </title>
            <aug>
               <au>
                  <snm>Muller-Ladner</snm>
                  <fnm>U</fnm>
               </au>
               <au>
                  <snm>Kriegsmann</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Franklin</snm>
                  <fnm>BN</fnm>
               </au>
               <au>
                  <snm>Matsumoto</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Geiler</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Gay</snm>
                  <fnm>RE</fnm>
               </au>
               <au>
                  <snm>Gay</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Am J Pathol</source>
            <pubdate>1996</pubdate>
            <volume>149</volume>
            <fpage>1607</fpage>
            <lpage>1615</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1865262</pubid>
                  <pubid idtype="pmpid">8909250</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>Invasiveness of fibroblast-like synoviocytes is an individual patient characteristic associated with the rate of joint destruction in patients with rheumatoid arthritis</p>
            </title>
            <aug>
               <au>
                  <snm>Tolboom</snm>
                  <fnm>TC</fnm>
               </au>
               <au>
                  <snm>Helm-Van Mil</snm>
                  <mnm>van der</mnm>
                  <fnm>AH</fnm>
               </au>
               <au>
                  <snm>Nelissen</snm>
                  <fnm>RG</fnm>
               </au>
               <au>
                  <snm>Breedveld</snm>
                  <fnm>FC</fnm>
               </au>
               <au>
                  <snm>Toes</snm>
                  <fnm>RE</fnm>
               </au>
               <au>
                  <snm>Huizinga</snm>
                  <fnm>TW</fnm>
               </au>
            </aug>
            <source>Arthritis Rheum</source>
            <pubdate>2005</pubdate>
            <volume>52</volume>
            <fpage>1999</fpage>
            <lpage>2002</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/art.21118</pubid>
                  <pubid idtype="pmpid" link="fulltext">15986342</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>The non-MHC quantitative trait locus Cia5 contains three major arthritis genes that differentially regulate disease severity, pannus formation, and joint damage in collagen- and pristane-induced arthritis</p>
            </title>
            <aug>
               <au>
                  <snm>Brenner</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Meng</snm>
                  <fnm>HC</fnm>
               </au>
               <au>
                  <snm>Yarlett</snm>
                  <fnm>NC</fnm>
               </au>
               <au>
                  <snm>Joe</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Griffiths</snm>
                  <fnm>MM</fnm>
               </au>
               <au>
                  <snm>Remmers</snm>
                  <fnm>EF</fnm>
               </au>
               <au>
                  <snm>Wilder</snm>
                  <fnm>RL</fnm>
               </au>
               <au>
                  <snm>Gulko</snm>
                  <fnm>PS</fnm>
               </au>
            </aug>
            <source>J Immunol</source>
            <pubdate>2005</pubdate>
            <volume>174</volume>
            <fpage>7894</fpage>
            <lpage>7903</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">15944295</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>The arthritis severity locus Cia5d is a novel genetic regulator of the invasive properties of synovial fibroblasts</p>
            </title>
            <aug>
               <au>
                  <snm>Laragione</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Brenner</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Mello</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Symons</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Gulko</snm>
                  <fnm>PS</fnm>
               </au>
            </aug>
            <source>Arthritis Rheum</source>
            <pubdate>2008</pubdate>
            <volume>58</volume>
            <fpage>2296</fpage>
            <lpage>2306</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/art.23610</pubid>
                  <pubid idtype="pmpid" link="fulltext">18668563</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>Pristane-induced arthritis in rats: a new model for rheumatoid arthritis with a chronic disease course influenced by both major histocompatibility complex and non-major histocompatibility complex genes</p>
            </title>
            <aug>
               <au>
                  <snm>Vingsbo</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Sahlstrand</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Brun</snm>
                  <fnm>JG</fnm>
               </au>
               <au>
                  <snm>Jonsson</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Saxne</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Holmdahl</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>Am J Pathol</source>
            <pubdate>1996</pubdate>
            <volume>149</volume>
            <fpage>1675</fpage>
            <lpage>1683</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1865278</pubid>
                  <pubid idtype="pmpid">8909256</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>Identification of a new non-major histocompatibility complex genetic locus on chromosome 2 that controls disease severity in collagen-induced arthritis in rats</p>
            </title>
            <aug>
               <au>
                  <snm>Gulko</snm>
                  <fnm>PS</fnm>
               </au>
               <au>
                  <snm>Kawahito</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Remmers</snm>
                  <fnm>EF</fnm>
               </au>
               <au>
                  <snm>Reese</snm>
                  <fnm>VR</fnm>
               </au>
               <au>
                  <snm>Wang</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Dracheva</snm>
                  <fnm>SV</fnm>
               </au>
               <au>
                  <snm>Ge</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Longman</snm>
                  <fnm>RE</fnm>
               </au>
               <au>
                  <snm>Shepard</snm>
                  <fnm>JS</fnm>
               </au>
               <au>
                  <snm>Cannon</snm>
                  <fnm>GW</fnm>
               </au>
               <au>
                  <snm>Sawitzke</snm>
                  <fnm>AD</fnm>
               </au>
               <au>
                  <snm>Wilder</snm>
                  <fnm>RL</fnm>
               </au>
               <au>
                  <snm>Griffiths</snm>
                  <fnm>MM</fnm>
               </au>
            </aug>
            <source>Arthrititis Rheum</source>
            <pubdate>1998</pubdate>
            <volume>41</volume>
            <fpage>2122</fpage>
            <lpage>2131</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">9870869</pubid>
                  <pubid idtype="doi">10.1002/1529-0131(199812)41:12&lt;2122::AID-ART7>3.0.CO;2-#</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>A genome scan localizes five non-MHC loci controlling collagen-induced arthritis in rats</p>
            </title>
            <aug>
               <au>
                  <snm>Remmers</snm>
                  <fnm>EF</fnm>
               </au>
               <au>
                  <snm>Longman</snm>
                  <fnm>RE</fnm>
               </au>
               <au>
                  <snm>Du</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>O'Hare</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Cannon</snm>
                  <fnm>GW</fnm>
               </au>
               <au>
                  <snm>Griffiths</snm>
                  <fnm>MM</fnm>
               </au>
               <au>
                  <snm>Wilder</snm>
                  <fnm>RL</fnm>
               </au>
            </aug>
            <source>Nat Genet</source>
            <pubdate>1996</pubdate>
            <volume>14</volume>
            <fpage>82</fpage>
            <lpage>85</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/ng0996-82</pubid>
                  <pubid idtype="pmpid" link="fulltext">8782824</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>Matrix metalloproteinase-2 activation in human hepatic fibrosis regulation by cell-matrix interactions</p>
            </title>
            <aug>
               <au>
                  <snm>Preaux</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Mallat</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Nhieu</snm>
                  <fnm>JT</fnm>
               </au>
               <au>
                  <snm>D'Ortho</snm>
                  <fnm>MP</fnm>
               </au>
               <au>
                  <snm>Hembry</snm>
                  <fnm>RM</fnm>
               </au>
               <au>
                  <snm>Mavier</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Hepatology</source>
            <pubdate>1999</pubdate>
            <volume>30</volume>
            <fpage>944</fpage>
            <lpage>950</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/hep.510300432</pubid>
                  <pubid idtype="pmpid" link="fulltext">10498646</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>Peripheral blood gene expression profiling in rheumatoid arthritis</p>
            </title>
            <aug>
               <au>
                  <snm>Batliwalla</snm>
                  <fnm>FM</fnm>
               </au>
               <au>
                  <snm>Baechler</snm>
                  <fnm>EC</fnm>
               </au>
               <au>
                  <snm>Xiao</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Li</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Balasubramanian</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Khalili</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Damle</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Ortmann</snm>
                  <fnm>WA</fnm>
               </au>
               <au>
                  <snm>Perrone</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Kantor</snm>
                  <fnm>AB</fnm>
               </au>
               <au>
                  <snm>Gulko</snm>
                  <fnm>PS</fnm>
               </au>
               <au>
                  <snm>Kern</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Furie</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Behrens</snm>
                  <fnm>TW</fnm>
               </au>
               <au>
                  <snm>Gregersen</snm>
                  <fnm>PK</fnm>
               </au>
            </aug>
            <source>Genes Immun</source>
            <pubdate>2005</pubdate>
            <volume>6</volume>
            <fpage>388</fpage>
            <lpage>397</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/sj.gene.6364209</pubid>
                  <pubid idtype="pmpid" link="fulltext">15973463</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>Zipf's law in importance of genes for cancer classification using microarray data</p>
            </title>
            <aug>
               <au>
                  <snm>Li</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Yang</snm>
                  <fnm>Y</fnm>
               </au>
            </aug>
            <source>J Theor Biol</source>
            <pubdate>2002</pubdate>
            <volume>219</volume>
            <fpage>539</fpage>
            <lpage>551</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/jtbi.2002.3145</pubid>
                  <pubid idtype="pmpid" link="fulltext">12425984</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>R statistical package</p>
            </title>
            <url>http://www.r-project.org/</url>
         </bibl>
         <bibl id="B23">
            <title>
               <p>Cluster analysis and display of genome-wide expression patterns</p>
            </title>
            <aug>
               <au>
                  <snm>Eisen</snm>
                  <fnm>MB</fnm>
               </au>
               <au>
                  <snm>Spellman</snm>
                  <fnm>PT</fnm>
               </au>
               <au>
                  <snm>Brown</snm>
                  <fnm>PO</fnm>
               </au>
               <au>
                  <snm>Botstein</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>1998</pubdate>
            <volume>95</volume>
            <fpage>14863</fpage>
            <lpage>14868</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">24541</pubid>
                  <pubid idtype="pmpid" link="fulltext">9843981</pubid>
                  <pubid idtype="doi">10.1073/pnas.95.25.14863</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>Treeview</p>
            </title>
            <url>http://rana.lbl.gov</url>
         </bibl>
         <bibl id="B25">
            <title>
               <p>Analysis of relative gene expression data using real-time quantitative PCR and the 2<sup>-&#916;&#916;CT </sup>method</p>
            </title>
            <aug>
               <au>
                  <snm>Livak</snm>
                  <fnm>KJ</fnm>
               </au>
               <au>
                  <snm>Schmittgen</snm>
                  <fnm>TD</fnm>
               </au>
            </aug>
            <source>Methods</source>
            <pubdate>2001</pubdate>
            <volume>25</volume>
            <fpage>402</fpage>
            <lpage>408</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/meth.2001.1262</pubid>
                  <pubid idtype="pmpid" link="fulltext">11846609</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>Isolation and characterization of rheumatoid arthritis synovial fibroblasts from primary culture: primary culture cells markedly differ from fourth-passage cells</p>
            </title>
            <aug>
               <au>
                  <snm>Zimmermann</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Kunisch</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Pfeiffer</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Hirth</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Stahl</snm>
                  <fnm>HD</fnm>
               </au>
               <au>
                  <snm>Sack</snm>
                  <fnm>U</fnm>
               </au>
               <au>
                  <snm>Laube</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Liesaus</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Roth</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Palombo-Kinne</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Emmrich</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Kinne</snm>
                  <fnm>RW</fnm>
               </au>
            </aug>
            <source>Arthritis Res</source>
            <pubdate>2001</pubdate>
            <volume>3</volume>
            <fpage>72</fpage>
            <lpage>76</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">17827</pubid>
                  <pubid idtype="pmpid" link="fulltext">11178129</pubid>
                  <pubid idtype="doi">10.1186/ar142</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B27">
            <title>
               <p>Invasive properties of fibroblast-like synoviocytes: correlation with growth characteristics and expression of MMP-1, MMP-3, and MMP-10</p>
            </title>
            <aug>
               <au>
                  <snm>Tolboom</snm>
                  <fnm>TC</fnm>
               </au>
               <au>
                  <snm>Pieterman</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Laan</snm>
                  <mnm>van der</mnm>
                  <fnm>WH</fnm>
               </au>
               <au>
                  <snm>Toes</snm>
                  <fnm>RE</fnm>
               </au>
               <au>
                  <snm>Huidekoper</snm>
                  <fnm>AL</fnm>
               </au>
               <au>
                  <snm>Nelissen</snm>
                  <fnm>RG</fnm>
               </au>
               <au>
                  <snm>Breedveld</snm>
                  <fnm>FC</fnm>
               </au>
               <au>
                  <snm>Huizinga</snm>
                  <fnm>TW</fnm>
               </au>
            </aug>
            <source>Ann Rheum Dis</source>
            <pubdate>2002</pubdate>
            <volume>61</volume>
            <fpage>975</fpage>
            <lpage>980</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1753950</pubid>
                  <pubid idtype="pmpid">12379519</pubid>
                  <pubid idtype="doi">10.1136/ard.61.11.975</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B28">
            <title>
               <p>Active synovial matrix metalloproteinase-2 is associated with radiographic erosions in patients with early synovitis</p>
            </title>
            <aug>
               <au>
                  <snm>Goldbach-Mansky</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Hoxworth</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Smith</snm>
                  <fnm>D</fnm>
                  <suf>2nd</suf>
               </au>
               <au>
                  <snm>Duray</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Schumacher</snm>
                  <fnm>RH</fnm>
                  <suf>Jr</suf>
               </au>
               <au>
                  <snm>Yarboro</snm>
                  <fnm>CH</fnm>
               </au>
               <au>
                  <snm>Klippel</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Kleiner</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>El-Gabalawy</snm>
                  <fnm>HS</fnm>
               </au>
            </aug>
            <source>Arthritis Res</source>
            <pubdate>2000</pubdate>
            <volume>2</volume>
            <fpage>145</fpage>
            <lpage>153</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">17808</pubid>
                  <pubid idtype="pmpid" link="fulltext">11062605</pubid>
                  <pubid idtype="doi">10.1186/ar79</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B29">
            <title>
               <p>Association of MMP-2 activation potential with metastatic progression in human breast cancer cell lines independent of MMP-2 production</p>
            </title>
            <aug>
               <au>
                  <snm>Azzam</snm>
                  <fnm>HS</fnm>
               </au>
               <au>
                  <snm>Arand</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Lippman</snm>
                  <fnm>ME</fnm>
               </au>
               <au>
                  <snm>Thompson</snm>
                  <fnm>EW</fnm>
               </au>
            </aug>
            <source>J Natl Cancer Inst</source>
            <pubdate>1993</pubdate>
            <volume>85</volume>
            <fpage>1758</fpage>
            <lpage>1764</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/jnci/85.21.1758</pubid>
                  <pubid idtype="pmpid" link="fulltext">8411260</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B30">
            <title>
               <p>Differential influence of antiestrogens on the <it>in vitro </it>release of gelatinases (type IV collagenases) by invasive and non-invasive breast cancer cells</p>
            </title>
            <aug>
               <au>
                  <snm>Abbas Abidi</snm>
                  <fnm>SM</fnm>
               </au>
               <au>
                  <snm>Howard</snm>
                  <fnm>EW</fnm>
               </au>
               <au>
                  <snm>Dmytryk</snm>
                  <fnm>JJ</fnm>
               </au>
               <au>
                  <snm>Pento</snm>
                  <fnm>JT</fnm>
               </au>
            </aug>
            <source>Clin Exp Metastasis</source>
            <pubdate>1997</pubdate>
            <volume>15</volume>
            <fpage>432</fpage>
            <lpage>439</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1023/A:1018458406797</pubid>
                  <pubid idtype="pmpid" link="fulltext">9219732</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B31">
            <title>
               <p>Correlation of serum metalloproteinase levels with lung cancer metastasis and response to therapy</p>
            </title>
            <aug>
               <au>
                  <snm>Garbisa</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Scagliotti</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Masiero</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Di Francesco</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Caenazzo</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Onisto</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Micela</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Stetler-Stevenson</snm>
                  <fnm>WG</fnm>
               </au>
               <au>
                  <snm>Liotta</snm>
                  <fnm>LA</fnm>
               </au>
            </aug>
            <source>Cancer Res</source>
            <pubdate>1992</pubdate>
            <volume>52</volume>
            <fpage>4548</fpage>
            <lpage>4549</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">1322794</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B32">
            <title>
               <p>Prognostic significance of circulating matrix metalloproteinase-2 to tissue inhibitor of metalloproteinases-2 ratio in recurrence of urothelial cancer after complete resection</p>
            </title>
            <aug>
               <au>
                  <snm>Gohji</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Fujimoto</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Fujii</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Komiyama</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Okawa</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Nakajima</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Cancer Res</source>
            <pubdate>1996</pubdate>
            <volume>56</volume>
            <fpage>3196</fpage>
            <lpage>3198</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">8764105</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B33">
            <title>
               <p>Prognostic value of MMP-2 immunoreactive protein (72 kD type IV collagenase) in primary skin melanoma</p>
            </title>
            <aug>
               <au>
                  <snm>Vaisanen</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Kallioinen</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Taskinen</snm>
                  <fnm>PJ</fnm>
               </au>
               <au>
                  <snm>Turpeenniemi-Hujanen</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>J Pathol</source>
            <pubdate>1998</pubdate>
            <volume>186</volume>
            <fpage>51</fpage>
            <lpage>58</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/(SICI)1096-9896(199809)186:1&lt;51::AID-PATH131>3.0.CO;2-P</pubid>
                  <pubid idtype="pmpid" link="fulltext">9875140</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B34">
            <title>
               <p>The role of matrix metalloproteinases in glioma invasion</p>
            </title>
            <aug>
               <au>
                  <snm>Nakada</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Okada</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Yamashita</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Front Biosci</source>
            <pubdate>2003</pubdate>
            <volume>8</volume>
            <fpage>e261</fpage>
            <lpage>269</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.2741/1016</pubid>
                  <pubid idtype="pmpid" link="fulltext">12456313</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B35">
            <title>
               <p>Matrix metalloproteinases and metastatic cancer</p>
            </title>
            <aug>
               <au>
                  <snm>Cockett</snm>
                  <fnm>MI</fnm>
               </au>
               <au>
                  <snm>Murphy</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Birch</snm>
                  <fnm>ML</fnm>
               </au>
               <au>
                  <snm>O'Connell</snm>
                  <fnm>JP</fnm>
               </au>
               <au>
                  <snm>Crabbe</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Millican</snm>
                  <fnm>AT</fnm>
               </au>
               <au>
                  <snm>Hart</snm>
                  <fnm>IR</fnm>
               </au>
               <au>
                  <snm>Docherty</snm>
                  <fnm>AJ</fnm>
               </au>
            </aug>
            <source>Biochem Soc Symp</source>
            <pubdate>1998</pubdate>
            <volume>63</volume>
            <fpage>295</fpage>
            <lpage>313</lpage>
            <xrefbib>
               <pubid idtype="pmpid">9513731</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B36">
            <title>
               <p>Levels of matrix metalloproteases in bladder cancer correlate with tumor grade and invasion</p>
            </title>
            <aug>
               <au>
                  <snm>Davies</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Waxman</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Wasan</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Abel</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Williams</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Krausz</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Neal</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Thomas</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Hanby</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Balkwill</snm>
                  <fnm>F</fnm>
               </au>
            </aug>
            <source>Cancer Res</source>
            <pubdate>1993</pubdate>
            <volume>53</volume>
            <fpage>5365</fpage>
            <lpage>5369</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">8221672</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B37">
            <title>
               <p>Fibroblast-like synoviocytes derived from patients with rheumatoid arthritis show the imprint of synovial tissue heterogeneity: evidence of a link between an increased myofibroblast-like phenotype and high-inflammation synovitis</p>
            </title>
            <aug>
               <au>
                  <snm>Kasperkovitz</snm>
                  <fnm>PV</fnm>
               </au>
               <au>
                  <snm>Timmer</snm>
                  <fnm>TC</fnm>
               </au>
               <au>
                  <snm>Smeets</snm>
                  <fnm>TJ</fnm>
               </au>
               <au>
                  <snm>Verbeet</snm>
                  <fnm>NL</fnm>
               </au>
               <au>
                  <snm>Tak</snm>
                  <fnm>PP</fnm>
               </au>
               <au>
                  <snm>van Baarsen</snm>
                  <fnm>LG</fnm>
               </au>
               <au>
                  <snm>Baltus</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Huizinga</snm>
                  <fnm>TW</fnm>
               </au>
               <au>
                  <snm>Pieterman</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Fero</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Firestein</snm>
                  <fnm>GS</fnm>
               </au>
               <au>
                  <snm>Pouw Kraan</snm>
                  <mnm>van der</mnm>
                  <fnm>TC</fnm>
               </au>
               <au>
                  <snm>Verweij</snm>
                  <fnm>CL</fnm>
               </au>
            </aug>
            <source>Arthritis Rheum</source>
            <pubdate>2005</pubdate>
            <volume>52</volume>
            <fpage>430</fpage>
            <lpage>441</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/art.20811</pubid>
                  <pubid idtype="pmpid" link="fulltext">15692990</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B38">
            <title>
               <p>A new player in oncogenesis: AUF1/hnRNPD overexpression leads to tumorigenesis in transgenic mice</p>
            </title>
            <aug>
               <au>
                  <snm>Gouble</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Grazide</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Meggetto</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Mercier</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Delsol</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Morello</snm>
                  <fnm>D</fnm>
               </au>
            </aug>
            <source>Cancer Res</source>
            <pubdate>2002</pubdate>
            <volume>62</volume>
            <fpage>1489</fpage>
            <lpage>1495</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">11888925</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B39">
            <title>
               <p>Transcriptional profiling of the transition from normal intestinal epithelia to adenomas and carcinomas in the APCMin/+ mouse</p>
            </title>
            <aug>
               <au>
                  <snm>Paoni</snm>
                  <fnm>NF</fnm>
               </au>
               <au>
                  <snm>Feldman</snm>
                  <fnm>MW</fnm>
               </au>
               <au>
                  <snm>Gutierrez</snm>
                  <fnm>LS</fnm>
               </au>
               <au>
                  <snm>Ploplis</snm>
                  <fnm>VA</fnm>
               </au>
               <au>
                  <snm>Castellino</snm>
                  <fnm>FJ</fnm>
               </au>
            </aug>
            <source>Physiol Genomics</source>
            <pubdate>2003</pubdate>
            <volume>15</volume>
            <fpage>228</fpage>
            <lpage>235</lpage>
            <xrefbib>
               <pubid idtype="pmpid">13130079</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B40">
            <title>
               <p>Glia maturation factor beta regulates the growth of N18 neuroblastoma cells</p>
            </title>
            <aug>
               <au>
                  <snm>Lim</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Liu</snm>
                  <fnm>YX</fnm>
               </au>
               <au>
                  <snm>Zaheer</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Dev Biol</source>
            <pubdate>1990</pubdate>
            <volume>137</volume>
            <fpage>444</fpage>
            <lpage>450</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0012-1606(90)90269-O</pubid>
                  <pubid idtype="pmpid">2303171</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B41">
            <title>
               <p>Activation of clg, a novel dbl family guanine nucleotide exchange factor gene, by proviral insertion at evi24, a common integration site in B cell and myeloid leukemias</p>
            </title>
            <aug>
               <au>
                  <snm>Himmel</snm>
                  <fnm>KL</fnm>
               </au>
               <au>
                  <snm>Bi</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Shen</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Jenkins</snm>
                  <fnm>NA</fnm>
               </au>
               <au>
                  <snm>Copeland</snm>
                  <fnm>NG</fnm>
               </au>
               <au>
                  <snm>Zheng</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Largaespada</snm>
                  <fnm>DA</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>2002</pubdate>
            <volume>277</volume>
            <fpage>13463</fpage>
            <lpage>13472</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1074/jbc.M110981200</pubid>
                  <pubid idtype="pmpid" link="fulltext">11839748</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B42">
            <title>
               <p>The induction of growth arrest DNA damage-inducible gene 45 beta in human hepatoma cell lines by S-adenosylmethionine</p>
            </title>
            <aug>
               <au>
                  <snm>Qiu</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Zhou</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Chu</snm>
                  <fnm>PG</fnm>
               </au>
               <au>
                  <snm>Luh</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Yen</snm>
                  <fnm>Y</fnm>
               </au>
            </aug>
            <source>Am J Pathol</source>
            <pubdate>2007</pubdate>
            <volume>171</volume>
            <fpage>287</fpage>
            <lpage>296</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1941600</pubid>
                  <pubid idtype="pmpid" link="fulltext">17591973</pubid>
                  <pubid idtype="doi">10.2353/ajpath.2007.070121</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B43">
            <title>
               <p>Identification of JAK/STAT signalling components by genome-wide RNA interference</p>
            </title>
            <aug>
               <au>
                  <snm>Muller</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Kuttenkeuler</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Gesellchen</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Zeidler</snm>
                  <fnm>MP</fnm>
               </au>
               <au>
                  <snm>Boutros</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Nature</source>
            <pubdate>2005</pubdate>
            <volume>436</volume>
            <fpage>871</fpage>
            <lpage>875</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/nature03869</pubid>
                  <pubid idtype="pmpid" link="fulltext">16094372</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B44">
            <title>
               <p>RNAi screen identifies UBE2D3 as a mediator of all-trans retinoic acid-induced cell growth arrest in human acute promyelocytic NB4 cells</p>
            </title>
            <aug>
               <au>
                  <snm>Hattori</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Zhang</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Jia</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Subramanian</snm>
                  <fnm>KK</fnm>
               </au>
               <au>
                  <snm>Jo</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Loison</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Newburger</snm>
                  <fnm>PE</fnm>
               </au>
               <au>
                  <snm>Luo</snm>
                  <fnm>HR</fnm>
               </au>
            </aug>
            <source>Blood</source>
            <pubdate>2007</pubdate>
            <volume>110</volume>
            <fpage>640</fpage>
            <lpage>650</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1924478</pubid>
                  <pubid idtype="pmpid" link="fulltext">17420285</pubid>
                  <pubid idtype="doi">10.1182/blood-2006-11-059048</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B45">
            <title>
               <p>Glia maturation factor promotes contact inhibition in cancer cells</p>
            </title>
            <aug>
               <au>
                  <snm>Lim</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Nakagawa</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Arnason</snm>
                  <fnm>BG</fnm>
               </au>
               <au>
                  <snm>Turriff</snm>
                  <fnm>DE</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>1981</pubdate>
            <volume>78</volume>
            <fpage>4373</fpage>
            <lpage>4377</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">319792</pubid>
                  <pubid idtype="pmpid">6945589</pubid>
                  <pubid idtype="doi">10.1073/pnas.78.7.4373</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B46">
            <title>
               <p>A molecular role for lysyl oxidase in breast cancer invasion</p>
            </title>
            <aug>
               <au>
                  <snm>Kirschmann</snm>
                  <fnm>DA</fnm>
               </au>
               <au>
                  <snm>Seftor</snm>
                  <fnm>EA</fnm>
               </au>
               <au>
                  <snm>Fong</snm>
                  <fnm>SF</fnm>
               </au>
               <au>
                  <snm>Nieva</snm>
                  <fnm>DR</fnm>
               </au>
               <au>
                  <snm>Sullivan</snm>
                  <fnm>CM</fnm>
               </au>
               <au>
                  <snm>Edwards</snm>
                  <fnm>EM</fnm>
               </au>
               <au>
                  <snm>Sommer</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Csiszar</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Hendrix</snm>
                  <fnm>MJ</fnm>
               </au>
            </aug>
            <source>Cancer Res</source>
            <pubdate>2002</pubdate>
            <volume>62</volume>
            <fpage>4478</fpage>
            <lpage>4483</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">12154058</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B47">
            <title>
               <p>Identification of MMP-1 as a putative breast cancer predictive marker by global gene expression analysis</p>
            </title>
            <aug>
               <au>
                  <snm>Poola</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>DeWitty</snm>
                  <fnm>RL</fnm>
               </au>
               <au>
                  <snm>Marshalleck</snm>
                  <fnm>JJ</fnm>
               </au>
               <au>
                  <snm>Bhatnagar</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Abraham</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Leffall</snm>
                  <fnm>LD</fnm>
               </au>
            </aug>
            <source>Nat Med</source>
            <pubdate>2005</pubdate>
            <volume>11</volume>
            <fpage>481</fpage>
            <lpage>483</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/nm1243</pubid>
                  <pubid idtype="pmpid" link="fulltext">15864312</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B48">
            <title>
               <p>CXCL10 promotes invasion-related properties in human colorectal carcinoma cells</p>
            </title>
            <aug>
               <au>
                  <snm>Zipin-Roitman</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Meshel</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Sagi-Assif</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Shalmon</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Avivi</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Pfeffer</snm>
                  <fnm>RM</fnm>
               </au>
               <au>
                  <snm>Witz</snm>
                  <fnm>IP</fnm>
               </au>
               <au>
                  <snm>Ben-Baruch</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Cancer Res</source>
            <pubdate>2007</pubdate>
            <volume>67</volume>
            <fpage>3396</fpage>
            <lpage>3405</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1158/0008-5472.CAN-06-3087</pubid>
                  <pubid idtype="pmpid" link="fulltext">17409450</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B49">
            <title>
               <p>Derivation and characterization of a Wilms' tumour cell line, WiT 49</p>
            </title>
            <aug>
               <au>
                  <snm>Alami</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Williams</snm>
                  <fnm>BR</fnm>
               </au>
               <au>
                  <snm>Yeger</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Int J Cancer</source>
            <pubdate>2003</pubdate>
            <volume>107</volume>
            <fpage>365</fpage>
            <lpage>374</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/ijc.11429</pubid>
                  <pubid idtype="pmpid" link="fulltext">14506735</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B50">
            <title>
               <p>Podocalyxin increases the aggressive phenotype of breast and prostate cancer cells <it>in vitro</it> through its interaction with ezrin</p>
            </title>
            <aug>
               <au>
                  <snm>Sizemore</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Cicek</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Sizemore</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Ng</snm>
                  <fnm>KP</fnm>
               </au>
               <au>
                  <snm>Casey</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Cancer Res</source>
            <pubdate>2007</pubdate>
            <volume>67</volume>
            <fpage>6183</fpage>
            <lpage>6191</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1158/0008-5472.CAN-06-3575</pubid>
                  <pubid idtype="pmpid" link="fulltext">17616675</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B51">
            <title>
               <p>Polymorphism discovery in 62 DNA repair genes and haplotype associations with risks for lung and head and neck cancers</p>
            </title>
            <aug>
               <au>
                  <snm>Michiels</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Danoy</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Dessen</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Bera</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Boulet</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Bouchardy</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Lathrop</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Sarasin</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Benhamou</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Carcinogenesis</source>
            <pubdate>2007</pubdate>
            <volume>28</volume>
            <fpage>1731</fpage>
            <lpage>1739</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/carcin/bgm111</pubid>
                  <pubid idtype="pmpid" link="fulltext">17494052</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B52">
            <title>
               <p>Replication protein A is an independent prognostic indicator with potential therapeutic implications in colon cancer</p>
            </title>
            <aug>
               <au>
                  <snm>Givalos</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Gakiopoulou</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Skliri</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Bousboukea</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Konstantinidou</snm>
                  <fnm>AE</fnm>
               </au>
               <au>
                  <snm>Korkolopoulou</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Lelouda</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Kouraklis</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Patsouris</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Karatzas</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Mod Pathol</source>
            <pubdate>2007</pubdate>
            <volume>20</volume>
            <fpage>159</fpage>
            <lpage>166</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/modpathol.3800719</pubid>
                  <pubid idtype="pmpid" link="fulltext">17361204</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B53">
            <title>
               <p>Identification of differentially expressed genes by serial analysis of gene expression in human prostate cancer</p>
            </title>
            <aug>
               <au>
                  <snm>Waghray</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Schober</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Feroze</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Yao</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Virgin</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Chen</snm>
                  <fnm>YQ</fnm>
               </au>
            </aug>
            <source>Cancer Res</source>
            <pubdate>2001</pubdate>
            <volume>61</volume>
            <fpage>4283</fpage>
            <lpage>4286</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">11358857</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B54">
            <title>
               <p>Identification of RASSF1A modulated genes in nasopharyngeal carcinoma</p>
            </title>
            <aug>
               <au>
                  <snm>Chow</snm>
                  <fnm>LS</fnm>
               </au>
               <au>
                  <snm>Lam</snm>
                  <fnm>CW</fnm>
               </au>
               <au>
                  <snm>Chan</snm>
                  <fnm>SY</fnm>
               </au>
               <au>
                  <snm>Tsao</snm>
                  <fnm>SW</fnm>
               </au>
               <au>
                  <snm>To</snm>
                  <fnm>KF</fnm>
               </au>
               <au>
                  <snm>Tong</snm>
                  <fnm>SF</fnm>
               </au>
               <au>
                  <snm>Hung</snm>
                  <fnm>WK</fnm>
               </au>
               <au>
                  <snm>Dammann</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Huang</snm>
                  <fnm>DP</fnm>
               </au>
               <au>
                  <snm>Lo</snm>
                  <fnm>KW</fnm>
               </au>
            </aug>
            <source>Oncogene</source>
            <pubdate>2006</pubdate>
            <volume>25</volume>
            <fpage>310</fpage>
            <lpage>316</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">16116475</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B55">
            <title>
               <p>The desmoplastic response to infiltrating breast carcinoma: gene expression at the site of primary invasion and implications for comparisons between tumor types</p>
            </title>
            <aug>
               <au>
                  <snm>Iacobuzio-Donahue</snm>
                  <fnm>CA</fnm>
               </au>
               <au>
                  <snm>Argani</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Hempen</snm>
                  <fnm>PM</fnm>
               </au>
               <au>
                  <snm>Jones</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Kern</snm>
                  <fnm>SE</fnm>
               </au>
            </aug>
            <source>Cancer Res</source>
            <pubdate>2002</pubdate>
            <volume>62</volume>
            <fpage>5351</fpage>
            <lpage>5357</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">12235006</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B56">
            <title>
               <p>Spreds, inhibitors of the Ras/ERK signal transduction, are dysregulated in human hepatocellular carcinoma and linked to the malignant phenotype of tumors</p>
            </title>
            <aug>
               <au>
                  <snm>Yoshida</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Hisamoto</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Akiba</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Koga</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Nakamura</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Tokunaga</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Hanada</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Kumemura</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Maeyama</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Harada</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Ogata</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Yano</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Kojiro</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Ueno</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Yoshimura</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Sata</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Oncogene</source>
            <pubdate>2006</pubdate>
            <volume>25</volume>
            <fpage>6056</fpage>
            <lpage>6066</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/sj.onc.1209635</pubid>
                  <pubid idtype="pmpid" link="fulltext">16652141</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B57">
            <title>
               <p>Ras pathway is required for the activation of MMP-2 secretion and for the invasion of src-transformed 3Y1</p>
            </title>
            <aug>
               <au>
                  <snm>Thant</snm>
                  <fnm>AA</fnm>
               </au>
               <au>
                  <snm>Sein</snm>
                  <fnm>TT</fnm>
               </au>
               <au>
                  <snm>Liu</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Machida</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Kikkawa</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Koike</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Seiki</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Matsuda</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Hamaguchi</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Oncogene</source>
            <pubdate>1999</pubdate>
            <volume>18</volume>
            <fpage>6555</fpage>
            <lpage>6563</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/sj.onc.1203049</pubid>
                  <pubid idtype="pmpid" link="fulltext">10597259</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B58">
            <title>
               <p>CXCR3-binding chemokines in multiple myeloma</p>
            </title>
            <aug>
               <au>
                  <snm>Pellegrino</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Antonaci</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Russo</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Merchionne</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Ribatti</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Vacca</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Dammacco</snm>
                  <fnm>F</fnm>
               </au>
            </aug>
            <source>Cancer Lett</source>
            <pubdate>2004</pubdate>
            <volume>207</volume>
            <fpage>221</fpage>
            <lpage>227</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.canlet.2003.10.036</pubid>
                  <pubid idtype="pmpid">15072832</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B59">
            <title>
               <p>High CXCR3 expression in synovial mast cells associated with CXCL9 and CXCL10 expression in inflammatory synovial tissues of patients with rheumatoid arthritis</p>
            </title>
            <aug>
               <au>
                  <snm>Ruschpler</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Lorenz</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Eichler</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Koczan</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Hanel</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Scholz</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Melzer</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Thiesen</snm>
                  <fnm>HJ</fnm>
               </au>
               <au>
                  <snm>Stiehl</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Arthritis Res Ther</source>
            <pubdate>2003</pubdate>
            <volume>5</volume>
            <fpage>R241</fpage>
            <lpage>R252</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">193722</pubid>
                  <pubid idtype="pmpid" link="fulltext">12932287</pubid>
                  <pubid idtype="doi">10.1186/ar783</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B60">
            <title>
               <p>The production of CXCR3-agonistic chemokines by synovial fibroblasts from patients with rheumatoid arthritis</p>
            </title>
            <aug>
               <au>
                  <snm>Ueno</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Yamamura</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Iwahashi</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Okamoto</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Aita</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Ogawa</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Makino</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Rheumatol Int</source>
            <pubdate>2005</pubdate>
            <volume>25</volume>
            <fpage>361</fpage>
            <lpage>367</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/s00296-004-0449-x</pubid>
                  <pubid idtype="pmpid" link="fulltext">15004722</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B61">
            <title>
               <p>CC and CXC chemokine receptors mediate migration, proliferation, and matrix metalloproteinase production by fibroblast-like synoviocytes from rheumatoid arthritis patients</p>
            </title>
            <aug>
               <au>
                  <snm>Garcia-Vicuna</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Gomez-Gaviro</snm>
                  <fnm>MV</fnm>
               </au>
               <au>
                  <snm>Dominguez-Luis</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Pec</snm>
                  <fnm>MK</fnm>
               </au>
               <au>
                  <snm>Gonzalez-Alvaro</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Alvaro-Gracia</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Diaz-Gonzalez</snm>
                  <fnm>F</fnm>
               </au>
            </aug>
            <source>Arthritis Rheum</source>
            <pubdate>2004</pubdate>
            <volume>50</volume>
            <fpage>3866</fpage>
            <lpage>3877</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/art.20615</pubid>
                  <pubid idtype="pmpid" link="fulltext">15593223</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B62">
            <title>
               <p>CCR3, CCR5, CCR8 and CXCR3 expression in memory T helper cells from allergic rhinitis patients, asymptomatically sensitized and healthy individuals</p>
            </title>
            <aug>
               <au>
                  <snm>Holse</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Assing</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Poulsen</snm>
                  <fnm>LK</fnm>
               </au>
            </aug>
            <source>Clin Mol Allergy</source>
            <pubdate>2006</pubdate>
            <volume>4</volume>
            <fpage>6</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1524796</pubid>
                  <pubid idtype="pmpid" link="fulltext">16623955</pubid>
                  <pubid idtype="doi">10.1186/1476-7961-4-6</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B63">
            <title>
               <p>Targeting the function of IFN-gamma-inducible protein 10 suppresses ongoing adjuvant arthritis</p>
            </title>
            <aug>
               <au>
                  <snm>Salomon</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Netzer</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Wildbaum</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Schif-Zuck</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Maor</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Karin</snm>
                  <fnm>N</fnm>
               </au>
            </aug>
            <source>J Immunol</source>
            <pubdate>2002</pubdate>
            <volume>169</volume>
            <fpage>2685</fpage>
            <lpage>2693</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">12193742</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B64">
            <title>
               <p>Blockade of chemokine receptor CXCR3 inhibits T cell recruitment to inflamed joints and decreases the severity of adjuvant arthritis</p>
            </title>
            <aug>
               <au>
                  <snm>Mohan</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Issekutz</snm>
                  <fnm>TB</fnm>
               </au>
            </aug>
            <source>J Immunol</source>
            <pubdate>2007</pubdate>
            <volume>179</volume>
            <fpage>8463</fpage>
            <lpage>8469</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">18056393</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B65">
            <title>
               <p>Recruitment of uterine NK cells: induction of CXC chemokine ligands 10 and 11 in human endometrium by estradiol and progesterone</p>
            </title>
            <aug>
               <au>
                  <snm>Sentman</snm>
                  <fnm>CL</fnm>
               </au>
               <au>
                  <snm>Meadows</snm>
                  <fnm>SK</fnm>
               </au>
               <au>
                  <snm>Wira</snm>
                  <fnm>CR</fnm>
               </au>
               <au>
                  <snm>Eriksson</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>J Immunol</source>
            <pubdate>2004</pubdate>
            <volume>173</volume>
            <fpage>6760</fpage>
            <lpage>6766</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">15557169</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B66">
            <title>
               <p>Reciprocal regulation by estradiol 17-beta of ezrin and cadherin-catenin complexes in pituitary GH3 cells</p>
            </title>
            <aug>
               <au>
                  <snm>Smith</snm>
                  <fnm>PM</fnm>
               </au>
               <au>
                  <snm>Heinrich</snm>
                  <fnm>CA</fnm>
               </au>
               <au>
                  <snm>Pappas</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Peluso</snm>
                  <fnm>JJ</fnm>
               </au>
               <au>
                  <snm>Cowan</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>White</snm>
                  <fnm>BA</fnm>
               </au>
            </aug>
            <source>Endocrine</source>
            <pubdate>2002</pubdate>
            <volume>17</volume>
            <fpage>219</fpage>
            <lpage>228</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1385/ENDO:17:3:219</pubid>
                  <pubid idtype="pmpid" link="fulltext">12108523</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B67">
            <title>
               <p>The novel estrogen-responsive B-box protein (EBBP) gene is tamoxifen-regulated in cells expressing an estrogen receptor DNA-binding domain mutant</p>
            </title>
            <aug>
               <au>
                  <snm>Liu</snm>
                  <fnm>HL</fnm>
               </au>
               <au>
                  <snm>Golder-Novoselsky</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Seto</snm>
                  <fnm>MH</fnm>
               </au>
               <au>
                  <snm>Webster</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>McClary</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Zajchowski</snm>
                  <fnm>DA</fnm>
               </au>
            </aug>
            <source>Mol Endocrinol</source>
            <pubdate>1998</pubdate>
            <volume>12</volume>
            <fpage>1733</fpage>
            <lpage>1748</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1210/me.12.11.1733</pubid>
                  <pubid idtype="pmpid" link="fulltext">9817599</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B68">
            <title>
               <p>Anti-proliferative effect of estrogen in breast cancer cells that re-express ERalpha is mediated by aberrant regulation of cell cycle genes</p>
            </title>
            <aug>
               <au>
                  <snm>Moggs</snm>
                  <fnm>JG</fnm>
               </au>
               <au>
                  <snm>Murphy</snm>
                  <fnm>TC</fnm>
               </au>
               <au>
                  <snm>Lim</snm>
                  <fnm>FL</fnm>
               </au>
               <au>
                  <snm>Moore</snm>
                  <fnm>DJ</fnm>
               </au>
               <au>
                  <snm>Stuckey</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Antrobus</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Kimber</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Orphanides</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>J Mol Endocrinol</source>
            <pubdate>2005</pubdate>
            <volume>34</volume>
            <fpage>535</fpage>
            <lpage>551</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1677/jme.1.01677</pubid>
                  <pubid idtype="pmpid" link="fulltext">15821115</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B69">
            <title>
               <p>Differential effects of estrogen and raloxifene on messenger RNA and matrix metalloproteinase 2 activity in the rat uterus</p>
            </title>
            <aug>
               <au>
                  <snm>Helvering</snm>
                  <fnm>LM</fnm>
               </au>
               <au>
                  <snm>Adrian</snm>
                  <fnm>MD</fnm>
               </au>
               <au>
                  <snm>Geiser</snm>
                  <fnm>AG</fnm>
               </au>
               <au>
                  <snm>Estrem</snm>
                  <fnm>ST</fnm>
               </au>
               <au>
                  <snm>Wei</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Huang</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Chen</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Dow</snm>
                  <fnm>ER</fnm>
               </au>
               <au>
                  <snm>Calley</snm>
                  <fnm>JN</fnm>
               </au>
               <au>
                  <snm>Dodge</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Grese</snm>
                  <fnm>TA</fnm>
               </au>
               <au>
                  <snm>Jones</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Halladay</snm>
                  <fnm>DL</fnm>
               </au>
               <au>
                  <snm>Miles</snm>
                  <fnm>RR</fnm>
               </au>
               <au>
                  <snm>Onyia</snm>
                  <fnm>JE</fnm>
               </au>
               <au>
                  <snm>Ma</snm>
                  <fnm>YL</fnm>
               </au>
               <au>
                  <snm>Sato</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Bryant</snm>
                  <fnm>HU</fnm>
               </au>
            </aug>
            <source>Biol Reprod</source>
            <pubdate>2005</pubdate>
            <volume>72</volume>
            <fpage>830</fpage>
            <lpage>841</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1095/biolreprod.104.034595</pubid>
                  <pubid idtype="pmpid" link="fulltext">15576828</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B70">
            <title>
               <p>Activation of matrix metalloproteinase-2 and -9 by 2- and 4-hydroxyestradiol</p>
            </title>
            <aug>
               <au>
                  <snm>Paquette</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Bisson</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Therriault</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Lemay</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Pare</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Banville</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Cantin</snm>
                  <fnm>AM</fnm>
               </au>
            </aug>
            <source>J Steroid Biochem Mol Biol</source>
            <pubdate>2003</pubdate>
            <volume>87</volume>
            <fpage>65</fpage>
            <lpage>73</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0960-0760(03)00386-8</pubid>
                  <pubid idtype="pmpid" link="fulltext">14630092</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B71">
            <title>
               <p>17beta-oestradiol enhances release of matrix metalloproteinase-2 from human vascular smooth muscle cells</p>
            </title>
            <aug>
               <au>
                  <snm>Wingrove</snm>
                  <fnm>CS</fnm>
               </au>
               <au>
                  <snm>Garr</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Godsland</snm>
                  <fnm>IF</fnm>
               </au>
               <au>
                  <snm>Stevenson</snm>
                  <fnm>JC</fnm>
               </au>
            </aug>
            <source>Biochim Biophys Acta</source>
            <pubdate>1998</pubdate>
            <volume>1406</volume>
            <fpage>169</fpage>
            <lpage>174</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">9573355</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B72">
            <title>
               <p>Ethanol stimulates the secretion of matrix metalloproteinases 2 and 9 in MCF-7 human breast cancer cells</p>
            </title>
            <aug>
               <au>
                  <snm>Etique</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Grillier-Vuissoz</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Flament</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Oncol Rep</source>
            <pubdate>2006</pubdate>
            <volume>15</volume>
            <fpage>603</fpage>
            <lpage>608</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">16465419</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B73">
            <title>
               <p>Letrozole as a potent inhibitor of cell proliferation and expression of metalloproteinases (MMP-2 and MMP-9) by human epithelial breast cancer cells</p>
            </title>
            <aug>
               <au>
                  <snm>Mitropoulou</snm>
                  <fnm>TN</fnm>
               </au>
               <au>
                  <snm>Tzanakakis</snm>
                  <fnm>GN</fnm>
               </au>
               <au>
                  <snm>Kletsas</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Kalofonos</snm>
                  <fnm>HP</fnm>
               </au>
               <au>
                  <snm>Karamanos</snm>
                  <fnm>NK</fnm>
               </au>
            </aug>
            <source>Int J Cancer</source>
            <pubdate>2003</pubdate>
            <volume>104</volume>
            <fpage>155</fpage>
            <lpage>160</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/ijc.10941</pubid>
                  <pubid idtype="pmpid" link="fulltext">12569569</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B74">
            <title>
               <p>Estrogen and progesterone regulation of human fibroblast-like synoviocyte function <it>in vitro</it>: implications in rheumatoid arthritis</p>
            </title>
            <aug>
               <au>
                  <snm>Khalkhali-Ellis</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Seftor</snm>
                  <fnm>EA</fnm>
               </au>
               <au>
                  <snm>Nieva</snm>
                  <fnm>DR</fnm>
               </au>
               <au>
                  <snm>Handa</snm>
                  <fnm>RJ</fnm>
               </au>
               <au>
                  <snm>Price</snm>
                  <fnm>RH</fnm>
                  <suf>Jr</suf>
               </au>
               <au>
                  <snm>Kirschmann</snm>
                  <fnm>DA</fnm>
               </au>
               <au>
                  <snm>Baragi</snm>
                  <fnm>VM</fnm>
               </au>
               <au>
                  <snm>Sharma</snm>
                  <fnm>RV</fnm>
               </au>
               <au>
                  <snm>Bhalla</snm>
                  <fnm>RC</fnm>
               </au>
               <au>
                  <snm>Moore</snm>
                  <fnm>TL</fnm>
               </au>
               <au>
                  <snm>Hendrix</snm>
                  <fnm>MJ</fnm>
               </au>
            </aug>
            <source>J Rheumatol</source>
            <pubdate>2000</pubdate>
            <volume>27</volume>
            <fpage>1622</fpage>
            <lpage>1631</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid">10914842</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B75">
            <title>
               <p>The complex role of estrogens in inflammation</p>
            </title>
            <aug>
               <au>
                  <snm>Straub</snm>
                  <fnm>RH</fnm>
               </au>
            </aug>
            <source>Endocr Rev</source>
            <pubdate>2007</pubdate>
            <volume>28</volume>
            <fpage>521</fpage>
            <lpage>574</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1210/er.2007-0001</pubid>
                  <pubid idtype="pmpid" link="fulltext">17640948</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B76">
            <title>
               <p>Evidence for an interferon-inducible gene, Ifi202, in the susceptibility to systemic lupus</p>
            </title>
            <aug>
               <au>
                  <snm>Rozzo</snm>
                  <fnm>SJ</fnm>
               </au>
               <au>
                  <snm>Allard</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Choubey</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Vyse</snm>
                  <fnm>TJ</fnm>
               </au>
               <au>
                  <snm>Izui</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Peltz</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Kotzin</snm>
                  <fnm>BL</fnm>
               </au>
            </aug>
            <source>Immunity</source>
            <pubdate>2001</pubdate>
            <volume>15</volume>
            <fpage>435</fpage>
            <lpage>443</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S1074-7613(01)00196-0</pubid>
                  <pubid idtype="pmpid" link="fulltext">11567633</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B77">
            <title>
               <p>Identification of complement factor 5 as a susceptibility locus for experimental allergic asthma</p>
            </title>
            <aug>
               <au>
                  <snm>Karp</snm>
                  <fnm>CL</fnm>
               </au>
               <au>
                  <snm>Grupe</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Schadt</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Ewart</snm>
                  <fnm>SL</fnm>
               </au>
               <au>
                  <snm>Keane-Moore</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Cuomo</snm>
                  <fnm>PJ</fnm>
               </au>
               <au>
                  <snm>K&#246;hl</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Wahl</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Kuperman</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Germer</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Aud</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Peltz</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Wills-Karp</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Nat Immunol</source>
            <pubdate>2000</pubdate>
            <volume>1</volume>
            <fpage>221</fpage>
            <lpage>226</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/79759</pubid>
                  <pubid idtype="pmpid" link="fulltext">10973279</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
      </refgrp>
   </bm>
</art>
