<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>ar2367</ui>
   <ji>ARJ</ji>
   <fm>
      <dochead>Research article</dochead>
      <bibl>
         <title>
            <p>Association of reduced heme oxygenase-1 with excessive Toll-like receptor 4 expression in peripheral blood mononuclear cells in Beh&#231;et's disease</p>
         </title>
         <aug>
            <au id="A1">
               <snm>Kirino</snm>
               <fnm>Yohei</fnm>
               <insr iid="I1"/>
               <email>kirino@yokohama-cu.ac.jp</email>
            </au>
            <au id="A2">
               <snm>Takeno</snm>
               <fnm>Mitsuhiro</fnm>
               <insr iid="I1"/>
               <email>m2takeno@med.yokohama-cu.ac.jp</email>
            </au>
            <au id="A3">
               <snm>Watanabe</snm>
               <fnm>Reikou</fnm>
               <insr iid="I1"/>
               <email>over.ice-coffee.1223@ezweb.ne.jp</email>
            </au>
            <au id="A4">
               <snm>Murakami</snm>
               <fnm>Shuji</fnm>
               <insr iid="I1"/>
               <email>t046048c@yokohama-cu.ac.jp</email>
            </au>
            <au id="A5">
               <snm>Kobayashi</snm>
               <fnm>Masayoshi</fnm>
               <insr iid="I1"/>
               <email>t046024g@yokohama-cu.ac.jp</email>
            </au>
            <au id="A6">
               <snm>Ideguchi</snm>
               <fnm>Haruko</fnm>
               <insr iid="I1"/>
               <email>ideguchi@cronos.ocn.ne.jp</email>
            </au>
            <au id="A7">
               <snm>Ihata</snm>
               <fnm>Atsushi</fnm>
               <insr iid="I1"/>
               <email>j-ihata0@fukuhp.yokohama-cu.ac.jp</email>
            </au>
            <au id="A8">
               <snm>Ohno</snm>
               <fnm>Shigeru</fnm>
               <insr iid="I1"/>
               <email>ohno@urahp.yokohama-cu.ac.jp</email>
            </au>
            <au id="A9">
               <snm>Ueda</snm>
               <fnm>Atsuhisa</fnm>
               <insr iid="I1"/>
               <email>aueda@med.yokohama-cu.ac.jp</email>
            </au>
            <au id="A10">
               <snm>Mizuki</snm>
               <fnm>Nobuhisa</fnm>
               <insr iid="I2"/>
               <email>mizunobu@med.yokohama-cu.ac.jp</email>
            </au>
            <au id="A11" ca="yes">
               <snm>Ishigatsubo</snm>
               <fnm>Yoshiaki</fnm>
               <insr iid="I1"/>
               <email>ishigats@med.yokohama-cu.ac.jp</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Department of Internal Medicine and Clinical Immunology, Yokohama City University Graduate School of Medicine, 236-0004, 3-9 Fukuura, Kanazawa-ku, Yokohama, Japan</p>
            </ins>
            <ins id="I2">
               <p>Department of Ophthalmology and Visual Science, Yokohama City University Graduate School of Medicine, 236-0004, 3-9 Fukuura, Kanazawa-ku, Yokohama, Japan</p>
            </ins>
         </insg>
         <source>Arthritis Research &amp; Therapy</source>
         <issn>1478-6354</issn>
         <pubdate>2008</pubdate>
         <volume>10</volume>
         <issue>1</issue>
         <fpage>R16</fpage>
         <url>http://arthritis-research.com/content/10/1/R16</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">18234118</pubid>
               <pubid idtype="doi">10.1186/ar2367</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>25</day>
               <month>7</month>
               <year>2007</year>
            </date>
         </rec>
         <revreq>
            <date>
               <day>30</day>
               <month>8</month>
               <year>2007</year>
            </date>
         </revreq>
         <revrec>
            <date>
               <day>6</day>
               <month>11</month>
               <year>2007</year>
            </date>
         </revrec>
         <acc>
            <date>
               <day>31</day>
               <month>01</month>
               <year>2008</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>31</day>
               <month>01</month>
               <year>2008</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2008</year>
         <collab>Kirino et al.; licensee BioMed Central Ltd.</collab>
         <note>This is an open access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Introduction</p>
               </st>
               <p>Toll-like receptors (TLRs) mediate signaling that triggers activation of the innate immune system, whereas heme oxygenase (HO)-1 (an inducible heme-degrading enzyme that is induced by various stresses) suppresses inflammatory responses. We investigated the interaction between TLR and HO-1 in an inflammatory disorder, namely Beh&#231;et's disease.</p>
            </sec>
            <sec>
               <st>
                  <p>Methods</p>
               </st>
               <p>Thirty-three patients with Beh&#231;et's disease and 30 healthy control individuals were included in the study. Expression levels of HO-1, TLR2 and TLR4 mRNA were semiquantitatively analyzed using a real-time PCR technique, and HO-1 protein level was determined by immunoblotting in peripheral blood mononuclear cells (PBMCs) and polymorphonuclear leukocytes. In some experiments, cells were stimulated with lipopolysaccharide or heat shock protein-60; these proteins are known to be ligands for TLR2 and 4.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>Levels of expression of HO-1 mRNA were significantly reduced in PBMCs from patients with active Beh&#231;et's disease, whereas those of TLR4, but not TLR2, were increased in PBMCs, regardless of disease activity. Moreover, HO-1 expression in PBMCs from patients with Beh&#231;et's disease was repressed in the presence of either lipopolysaccharide or heat shock protein-60.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>The results suggest that upregulated TLR4 is associated with HO-1 reduction in PBMCs from patients with Beh&#231;et's disease, leading to augmented inflammatory responses.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <bdy>
      <sec>
         <st>
            <p>Introduction</p>
         </st>
         <p>Beh&#231;et's disease (BD) is an inflammatory disorder of unknown cause, characterized by recurrent oral aphthous ulcers, genital ulcers, uveitis, and skin lesions <abbrgrp><abbr bid="B1">1</abbr></abbrgrp>. A close association of the human leukocyte antigen (HLA)-B51 allele with the disease suggests that genetic predisposition contributes to susceptibility to BD <abbrgrp><abbr bid="B2">2</abbr></abbrgrp>. In addition, infections with agents such as herpes simplex virus <abbrgrp><abbr bid="B3">3</abbr><abbr bid="B4">4</abbr></abbrgrp> and <it>Streptococcus sanguis </it><abbrgrp><abbr bid="B5">5</abbr></abbrgrp> has been implicated in the development of BD, although no specific infectious agent has been identified as its cause <abbrgrp><abbr bid="B6">6</abbr></abbrgrp>. Rather, several reports have suggested that ubiquitous antigens presented by micro-organisms, such as heat shock proteins (HSPs), trigger crossreactive autoimmune responses through molecular mimicry machinery, which results in BD <abbrgrp><abbr bid="B6">6</abbr></abbrgrp>.</p>
         <p>Not just acquired but also innate immune systems are activated in BD, because hyperfunction of neutrophils is a hallmark of the disease <abbrgrp><abbr bid="B7">7</abbr></abbrgrp>. However, the immunopathological mechanisms remain uncertain. Toll-like receptors (TLRs), which are expressed on phagocytes and other cells, recognize 'pathogen-associated molecular patterns' in microbes and mediate inflammatory signal transduction <abbrgrp><abbr bid="B8">8</abbr><abbr bid="B9">9</abbr></abbrgrp>. TLR2 and TLR4 recognize lipoproteins and lipopolysaccharide (LPS), respectively. Furthermore, both receptors also bind to the endogenous 60 kDa HSP (HSP60), leading to cell activation <abbrgrp><abbr bid="B10">10</abbr><abbr bid="B11">11</abbr></abbrgrp>. It is becoming clear that TLRs are involved in systemic autoimmune disorders, because it was recently demonstrated TLR2 and TLR4 are involved in rheumatoid arthritis (RA) <abbrgrp><abbr bid="B12">12</abbr><abbr bid="B13">13</abbr><abbr bid="B14">14</abbr></abbrgrp> and TLR9 in systemic lupus erythematosus <abbrgrp><abbr bid="B15">15</abbr><abbr bid="B16">16</abbr></abbrgrp>. These findings have led to the hypothesis that microbial antigens not only trigger autoimmune responses through specific T-cell receptors but they also activate the innate immune system through the TLRs, leading to the inflammation that is characteristic of BD <abbrgrp><abbr bid="B17">17</abbr></abbrgrp>.</p>
         <p>Few studies have been conducted to investigate the role played by the regulatory systems in inflammatory diseases of humans, including BD. We are interested in heme oxygenase (HO)-1, because accumulating evidence suggests that HO-1 protects the host in a variety of pathologic conditions <abbrgrp><abbr bid="B18">18</abbr><abbr bid="B19">19</abbr></abbrgrp>. Our laboratory has demonstrated the beneficial role of HO-1 in inflammatory lung disease <abbrgrp><abbr bid="B20">20</abbr></abbrgrp> and lupus nephritis <abbrgrp><abbr bid="B21">21</abbr></abbrgrp>. On the other hand, a deficiency in HO-1 expression is associated with severe chronic inflammation, as demonstrated by studies conducted in HO-1 knockout mice <abbrgrp><abbr bid="B22">22</abbr></abbrgrp> and observations in a patient with HO-1 deficiency <abbrgrp><abbr bid="B23">23</abbr></abbrgrp>. These findings are consistent with the notion that HO-1 plays a physiologic role in protecting against inflammation. Furthermore, our recent studies <abbrgrp><abbr bid="B24">24</abbr><abbr bid="B25">25</abbr><abbr bid="B26">26</abbr></abbrgrp> have demonstrated substantial pathologic roles of HO-1 in rheumatic diseases. Abundant expression of HO-1 was identified in synovial tissues of patients with RA, in the absence of elevated serum HO-1 levels <abbrgrp><abbr bid="B24">24</abbr><abbr bid="B25">25</abbr></abbrgrp>. Further analysis using RA synovial cell lines suggests that HO-1 plays a regulatory role in RA inflammation <abbrgrp><abbr bid="B25">25</abbr></abbrgrp>. Our recent study <abbrgrp><abbr bid="B26">26</abbr></abbrgrp> showed that tumor necrosis factor (TNF) suppresses HO-1 expression in human monocytes, leading to augmentation of inflammatory responses, and that clinical efficacy of anti-TNF therapy is associated with restoration of HO-1 expression in circulating monocytes from patients with RA <abbrgrp><abbr bid="B26">26</abbr></abbrgrp>. In another study <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>, HO-1 gene therapy successfully ameliorated lung injury induced by LPS, which stimulates the innate immune system through TLR4. It is thus of interest to study the relationship between TLRs, as activating factors, and HO-1, as a regulatory factor of inflammatory responses in inflammatory disorders.</p>
         <p>In the present study, mRNA expression levels of HO-1, TLR2, and TLR4 in circulating leukocytes from BD patients were determined. The data suggest that activation signals through essentially over-expressed TLR4 cause reduction in HO-1 expression in peripheral blood mononuclear cells (PBMC), resulting in an augmentation of inflammatory responses in BD.</p>
      </sec>
      <sec>
         <st>
            <p>Materials and methods</p>
         </st>
         <sec>
            <st>
               <p>Patients and healthy donors</p>
            </st>
            <p>Thirty-three patients with BD, who met the International Study Group criteria for diagnosis of BD <abbrgrp><abbr bid="B27">27</abbr></abbrgrp>, were enrolled in the study. Their mean age was 47.7 &#177; 15.0 years, and 13 were male and 20 were female.</p>
            <p>All of the patients were under the care of the Yokohama City University Hospital. As previously described <abbrgrp><abbr bid="B28">28</abbr></abbrgrp>, 13 patients with one or more lesions (including genital ulcers, uveitis, erythema nodosum, arthritis, gastrointestinal lesions, central nervous system lesions, and/or C-reactive protein >10 mg/l) were regarded to have active disease during the study.</p>
            <p>The patients had been treated with a combination of the following agents: colchicines (17 patients), corticosteroids (13 patients), nonsteroidal anti-inflammatory drugs (14 patients), sulfasalazine (two patients), and cytotoxic drugs such as methotrexate (one patient), cyclosporine (four patients), tacrolimus (one patient) and cyclophosphamide (one patient). Thirty healthy age- and sex-matched individuals were also included as a control group. HLA-B type was determined by SRL Inc. (Tokyo, Japan) using lymphocyte cytotoxicity assay or a PCR reverse sequence specific oligonucleotides method. All experiments were conducted after written informed consent has been obtained, which was approved by the local institutional review board.</p>
         </sec>
         <sec>
            <st>
               <p>Reagents</p>
            </st>
            <p>Reagents were obtained from the following manufactures: recombinant human TNF-&#945; (R&amp;D; Minneapolis, MN, USA), polymyxin B and LPS <it>Escherichia coli </it>O111: B4 (Calbiochem; La Jolla, CA, USA), low endotoxin recombinant human HSP60 (Stressgen; Victoria, Canada), and IgG<sub>1</sub>&#954; (Serotech; Oxford, UK). Infliximab was kindly provided by Tanabe Seiyaku (Osaka, Japan).</p>
         </sec>
         <sec>
            <st>
               <p>Cell preparation and culture</p>
            </st>
            <p>PBMCs and polymorphonuclear leukocytes (PMNs) were isolated by centrifugation over two Ficoll-Hypaques gradients of specific gravities 1.077 (ICN; Aurora, OH, USA) and 1.119 (Nacalai; Kyoto, Japan). Purity of the separated neutrophils, which were determined by flow cytomeric scattergram, was typically above 97% <abbrgrp><abbr bid="B7">7</abbr></abbrgrp>. Monocytes were negatively selected by magnetic cell sorting (Miltenyi Biotec; Gladbach, Germany) using a monocyte isolation kit (Miltenyi Biotec). More than 95% of the obtained monocytes expressed CD14, based on flowcytomeric analysis <abbrgrp><abbr bid="B26">26</abbr></abbrgrp>.</p>
            <p>The cells were incubated in hepes modified RPMI1640 (Sigma-Aldrich; Saint Louis, MO, USA) containing 10% fetal calf serum (Equitech-bio; Kerrville, TX, USA), 2 mmol/l L-glutamine (Sigma-Aldrich), 100 U/ml penicillin plus 100 &#956;g/ml streptomycin (Sigma-Aldrich) in a 5% carbon dioxide in an air incubator at 37&#176;C. To determine HO-1 expression at mRNA and protein levels, cells were cultured in the presence or absence of LPS (10 ng/ml) or HSP60 (3 &#956;g/ml) for 6 to 24 hours.</p>
         </sec>
         <sec>
            <st>
               <p>Transfection</p>
            </st>
            <p>Purified monocytes (1 &#215; 10<sup>6</sup>) were transfected with 3 &#956;g of human HO-1 expression vector or control vector by using Nucleofector (Amaxa Biosystems; Gaithersburg, MD, USA) and human monocyte Nucleofector kit (Amaxa Biosystems) <abbrgrp><abbr bid="B25">25</abbr><abbr bid="B26">26</abbr></abbrgrp>. Twenty four hours later, the cells were used for further experiments.</p>
         </sec>
         <sec>
            <st>
               <p>Reverse transcription PCR and Real-time PCR</p>
            </st>
            <p>Total RNA was isolated from cells with TRIzol reagent (Invitrogen, Carlsbad, CA, USA) <abbrgrp><abbr bid="B21">21</abbr><abbr bid="B24">24</abbr><abbr bid="B25">25</abbr><abbr bid="B26">26</abbr></abbrgrp>. One microgram of total RNA served as a template for single-stranded cDNA synthesis in a reaction using oligo (dT) primers and SuperScript II (Invitrogen). For the reverse transcription PCR, 1 &#956;l cDNA was incubated with 9.375 &#956;l de-ionized distilled water, 2 &#956;l dNTP, 2.5 &#956;l 10 &#215; PCR buffer, 0.125 &#956;l Taq polymerase (Takara, Ohtsu, Japan), and primer pairs for target genes. The primers used in the study are summarized in Table <tblr tid="T1">1</tblr>.</p>
            <tbl id="T1" hint_layout="double">
               <title>
                  <p>Table 1</p>
               </title>
               <caption>
                  <p>Primers used in the study</p>
               </caption>
               <tblbdy cols="3">
                  <r>
                     <c ca="left">
                        <p>Primer</p>
                     </c>
                     <c ca="left">
                        <p>Sense/antisense</p>
                     </c>
                     <c ca="left">
                        <p>Sequence</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="3">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>HO-1</p>
                     </c>
                     <c ca="left">
                        <p>Sense</p>
                     </c>
                     <c ca="left">
                        <p>
                           <monospace>CAGGCAGAGAATGCTGAG</monospace>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>Antisense</p>
                     </c>
                     <c ca="left">
                        <p>
                           <monospace>GCTTCACATAGCGCTGCA</monospace>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TLR2</p>
                     </c>
                     <c ca="left">
                        <p>Sense</p>
                     </c>
                     <c ca="left">
                        <p>
                           <monospace>TGACTGCTCGGAGTTCTCCC</monospace>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>Antisense</p>
                     </c>
                     <c ca="left">
                        <p>
                           <monospace>GTCAGCACCAGAGCCTGGAG</monospace>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TLR4</p>
                     </c>
                     <c ca="left">
                        <p>Sense</p>
                     </c>
                     <c ca="left">
                        <p>
                           <monospace>GCGGCTCGAGGAAGAGAAGA</monospace>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>Antisense</p>
                     </c>
                     <c ca="left">
                        <p>
                           <monospace>AGGCTCTGATATGCCCCATC</monospace>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>GAPDH</p>
                     </c>
                     <c ca="left">
                        <p>Sense</p>
                     </c>
                     <c ca="left">
                        <p>
                           <monospace>ACAGTCAGCCGCATC</monospace>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>Antisense</p>
                     </c>
                     <c ca="left">
                        <p>
                           <monospace>AGGTGCGGCTCCCTA</monospace>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>TNF-&#945;</p>
                     </c>
                     <c ca="left">
                        <p>Sense</p>
                     </c>
                     <c ca="left">
                        <p>
                           <monospace>ATGAGCACTGAAAGCATGATC</monospace>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>Antisense</p>
                     </c>
                     <c ca="left">
                        <p>
                           <monospace>GGCGATGCGGCTGATGGT</monospace>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>CD14</p>
                     </c>
                     <c ca="left">
                        <p>Sense</p>
                     </c>
                     <c ca="left">
                        <p>
                           <monospace>CGGCCGAAGAGTTCACAAGT</monospace>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>Antisense</p>
                     </c>
                     <c ca="left">
                        <p>
                           <monospace>AGTGCAGTCCTGTGGCTTC</monospace>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>MD-2</p>
                     </c>
                     <c ca="left">
                        <p>Sense</p>
                     </c>
                     <c ca="left">
                        <p>
                           <monospace>TAAATCTTTTCTGCTTACTGA</monospace>
                        </p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>Antisense</p>
                     </c>
                     <c ca="left">
                        <p>
                           <monospace>TACTCAATTTATTCTAATTTGAAT</monospace>
                        </p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>HO, heme oxygenase; MD, Myeloid differentiation factor-2 ; TLR, Toll-like receptor; TNF, tumor necrosis factor; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.</p>
               </tblfn>
            </tbl>
            <p>Cycling conditions included 35 cycles of amplification for 30 seconds at 94&#176;C, 30 seconds at 55&#176;C, 1 minute at 72&#176;C, and a final extension phase consisting of one cycle of 10 minutes at 72&#176;C. The primers and probes for human HO-1, TLR2, TLR4, CD14, TNF-&#945;, MD-2 (Myeloid differentiation factor-2), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) used in the real-time PCR were purchased from PE Applied Biosystems (Foster City, CA, USA). Real-time PCR was performed using a BD Qtaq DNA polymerase (BD Bioscience), and the data were analyzed by the ABI prism 7700 sequence detection system (PE Applied Biosystems, Franklin Lakes, NJ, USA). Briefly, 1/50 of cDNA derived from 1 &#956;g total RNA, 200 nmol/l probe, and 800 nmol/l primers were incubated in 25 &#956;l at 50&#176;C for 2 minutes and 95&#176;C for 10 minutes, followed by 40 cycles of 95&#176;C for 15 seconds and 60&#176;C for 1 minute. The analysis system determined the number of cycles at which the amplified DNA in the sample exceeded the threshold during the PCR. Gene expression levels of the individual samples were calculated on standard curves of each cDNA generated by serial dilutions of the PCR amplified products. The data on HO-1, TLR2, TLR4, and TNF-&#945; were standardized to the expression of GAPDH in the same samples, using multiplex PCR technique. Expression level of HO-1 mRNA in a sample is indicated as arbitrary units.</p>
         </sec>
         <sec>
            <st>
               <p>Immunoblot analysis</p>
            </st>
            <p>The expression of HO-1 protein was determined by immunoblotting as described previously <abbrgrp><abbr bid="B25">25</abbr></abbrgrp>. Briefly, cells were treated with lysis buffer (137 mmol/l NaCl, 20 mmol/l Tris-HCl, 50 mmol/l NaF, 1 mmol/l EDTA, and Triton-X), supplemented with a protease inhibitor cocktail (Sigma-Aldrich) for 30 minutes on ice, and the supernatants were recovered by centrifugation at 15,000 rpm for 30 minutes. For TLR2 and TLR4 immunoblotting, after addition of lysis buffer, cells were homogenized for 15 minutes by ultrasonifier (Branson Japan, Kanagawa, Japan). The samples were resolved electrophoretically on a 4% to 20% gradient of polyacrylamide gel (Daiichi Kagaku, Tokyo, Japan) and transferred onto a polyvinyldene difluoride membrane (Millipore, Billerica, MA, USA). After blocking with 5% skimmed milk/Tris-buffered saline overnight at 4&#176;C, the membrane was incubated with optimally diluted anti-HO-1 monoclonal antibody (Stressgen), anti-TLR2 and anti-TLR4 (Imgenex, San Diego, CA, USA) monoclonal antibody, or anti-actin goat polyclonal antibody (Santa Cruz Biotechnology, Santa Cruz, CA, USA) for 1 hour at room temperature or overnight at 4&#176;C, and subsequently for 45 minutes with horseradish peroxidase-conjugated anti-mouse secondary antibody (Amersham Life Sciences, Piscataway, NJ, USA) or rabbit anti-goat IgG horseradish peroxidase conjugate (Zymed, South San Francisco, CA, USA). The signals were developed by using the enhanced chemiluminescence detection system (Amersham Life Sciences). The amount of blotted protein was measured densitometrically by using Scion image analysis and image processing software (NIH Image Engineering, Bethesda, MD, USA).</p>
         </sec>
         <sec>
            <st>
               <p>Statistical analysis</p>
            </st>
            <p>Mann-Whitney U-test, Kruskal-Wallis test with post-hoc Scheffe's test, paired <it>t</it>-test, and regression analysis were used to test for differences. <it>P </it>values less than 0.05 were considered statistically significant.</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Results</p>
         </st>
         <sec>
            <st>
               <p>Reduced HO-1 mRNA expression in PBMCs from patients with active BD</p>
            </st>
            <p>HO-1 mRNA expression level was determined in circulating leukocytes from BD patients by using a real-time PCR technique (Figure <figr fid="F1">1</figr>). A good correlation between HO-1 mRNA and protein levels has been demonstrated <abbrgrp><abbr bid="B26">26</abbr></abbrgrp>. Consistent with previous findings <abbrgrp><abbr bid="B24">24</abbr></abbrgrp>, we found no significant difference in HO-1 mRNA expression in PBMCs between BD patients (including both patients with active and those with inactive disease) and healthy control individuals (data not shown). A more detailed analysis based on disease activity, however, revealed that PBMCs from patients with active BD, but not those with inactive disease, expressed significantly lower HO-1 mRNA levels than did PBMCs from healthy control individuals (Figure <figr fid="F1">1a</figr>). Because HO-1 is preferentially expressed by monocytes among PBMCs, amounts of HO-1 mRNA may depend on the proportion of monocytes detected <abbrgrp><abbr bid="B26">26</abbr></abbrgrp>. CD14 mRNA levels determined by real-time PCR were comparable between BD and healthy control individuals, indicating that there was no difference between groups in the proportion of monocytes among circulating leukocytes (data not shown). Moreover, no significant difference was found in absolute counts of monocytes between patients with active BD and those with inactive disease (active 497.9 &#177; 218.8/&#956;l versus inactive 462.7 &#177; 182.4/&#956;l; <it>P </it>= 0.77, by Mann-Whitney U-test), indicating that HO-1 expression was reduced in individual cells from patients with active disease. As shown in Figure <figr fid="F1">1b</figr>, HO-1 mRNA levels in PMNs were not significantly different between BD patients and control individuals (Figure <figr fid="F1">1b</figr>).</p>
            <fig id="F1">
               <title>
                  <p>Figure 1</p>
               </title>
               <caption>
                  <p>HO-1 mRNA expression in PBMCs and PMNs from patients with BD</p>
               </caption>
               <text>
                  <p>HO-1 mRNA expression in PBMCs and PMNs from patients with BD. <b>(a) </b>Peripheral blood mononuclear cell (PBMC) heme oxygenase (HO)-1 mRNA expression in healthy controls (HC), and patients with active and inactive Beh&#231;et's disease (BD) were determined semiquantitatively by real-time PCR. Horizontal bars represent mean values of HO-1 mRNA. <b>(b) </b>Polymorphonuclear leukocyte (PMN) HO-1 mRNA expression levels of HC, and patients with active and inactive BD. *<it>P </it>&lt; 0.05, as determined using the Kruskal-Wallis test with post-hoc Scheffe's test. AU, arbitrary unit; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; NS, not significant.</p>
               </text>
               <graphic file="ar2367-1"/>
            </fig>
            <p>No particular clinical manifestations, including ocular lesions (Table <tblr tid="T2">2</tblr>) and treatments (data not shown), were associated with the reduction in HO-1 mRNA expression in PBMCs. There were no differences in mRNA expression levels of HO-1 and TLRs between HLA-B51-positive and -negative patients (Table <tblr tid="T2">2</tblr>). Levels of HO-1 mRNA expression were not altered by treatment with colchicine or prednisolone in the patients (data not shown).</p>
            <tbl id="T2" hint_layout="double">
               <title>
                  <p>Table 2</p>
               </title>
               <caption>
                  <p>HO-1 mRNA expression in patients with BD</p>
               </caption>
               <tblbdy cols="6">
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>PBMCs/PMNs</p>
                     </c>
                     <c cspan="2" ca="left">
                        <p>Ocular involvement</p>
                     </c>
                     <c cspan="2" ca="left">
                        <p>HLA-B51</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c cspan="4">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>- (<it>n </it>= 17)</p>
                     </c>
                     <c ca="left">
                        <p>+ (<it>n </it>= 16)</p>
                     </c>
                     <c ca="left">
                        <p>- (<it>n </it>= 10)</p>
                     </c>
                     <c ca="left">
                        <p>+ (<it>n </it>= 14)</p>
                     </c>
                  </r>
                  <r>
                     <c cspan="6">
                        <hr/>
                     </c>
                  </r>
                  <r>
                     <c ca="left">
                        <p>HO-1 (AU)</p>
                     </c>
                     <c ca="left">
                        <p>PBMCs</p>
                     </c>
                     <c ca="left">
                        <p>7.7 &#177; 3.1</p>
                     </c>
                     <c ca="left">
                        <p>5.7 &#177; 4.1</p>
                     </c>
                     <c ca="left">
                        <p>8.1 &#177; 3.9</p>
                     </c>
                     <c ca="left">
                        <p>5.6 &#177; 3.7</p>
                     </c>
                  </r>
                  <r>
                     <c>
                        <p/>
                     </c>
                     <c ca="left">
                        <p>PMNs</p>
                     </c>
                     <c ca="left">
                        <p>32.9 &#177; 46.1</p>
                     </c>
                     <c ca="left">
                        <p>31.6 &#177; 34.1</p>
                     </c>
                     <c ca="left">
                        <p>31.6 &#177; 38.0</p>
                     </c>
                     <c ca="left">
                        <p>19.9 &#177; 18.0</p>
                     </c>
                  </r>
               </tblbdy>
               <tblfn>
                  <p>Values are expressed as mean &#177; standard deviation. AU, arbitrary unit; BD, Beh&#231;et's disease; HLA, human leukocyte antigen; HO, heme oxygenase; PBMC, peripheral blood mononuclear cells; PMN, peripheral blood multinuclear cells.</p>
               </tblfn>
            </tbl>
         </sec>
         <sec>
            <st>
               <p>Increased TLR4, but not TLR2, expression by PBMCs from BD patients</p>
            </st>
            <p>Because HSP60 has been implicated in the pathogenesis of BD <abbrgrp><abbr bid="B17">17</abbr></abbrgrp>, levels of mRNA for TLR2 and TLR4 (both of which recognize HSP60 as a ligand) were examined in PBMCs and PMNs from patients with BD (Figure <figr fid="F2">2</figr>). In preliminary experiments, the relationship between levels of TLR mRNA and protein in circulating leukocytes was examined. Briefly, after fractionating PBMCs into CD14-positive cells and CD14-depleted cells by means of magnetic cell sorting, mRNA and protein levels of TLRs were compared by using real-time PCR and immunoblotting techniques, respectively. TLR4 was preferentially expressed on CD14-positive cells, but not CD14-depleted cells, at both mRNA and protein levels (Additional file <supplr sid="S1">1</supplr>). Moreover, TLR4 and TLR mRNA levels correlated well with protein levels.</p>
            <suppl id="S1">
               <title>
                  <p>Additional file 1</p>
               </title>
               <text>
                  <p>The Protein and mRNA TLR2, TLR4 and HO-1 expression levels in PBMCs. (A) TLR2, TLR4, HO-1, and actin protein expression in PBMCs and CD14<sup>+/- </sup>cells from a healthy control individual (HC). (b) TLR2, TLR4, CD14, and &#946;-actin mRNA expression levels in CD14<sup>+/- </sup>cells from HCs. (C) Correlation between densitometrically analyzed HO-1 protein levels and semiquantatively evaluated HO-1 mRNA expression by real-time PCR in PBMCs and CD14<sup>+/- </sup>cells from a HC.</p>
               </text>
               <file name="ar2367-S1.TIFF">
                  <p>Click here for file</p>
               </file>
            </suppl>
            <fig id="F2">
               <title>
                  <p>Figure 2</p>
               </title>
               <caption>
                  <p>TLR2 and TLR4 mRNA expression in PBMCs and PMNs from patients with BD</p>
               </caption>
               <text>
                  <p>TLR2 and TLR4 mRNA expression in PBMCs and PMNs from patients with BD. Expression levels in peripheral blood mononuclear cells (PBMCs) of <b>(a) </b>Toll-like receptor (TLR)2 and <b>(b) </b>TLR4 mRNA in healthy controls (HC), and patients with active and inactive Beh&#231;et's disease (BD) were determined semiquantitatively by real-time PCR. Horizontal bars represent mean values of HO-1 mRNA. Expression levels in polymorphonuclear leukocytes (PMNs) of <b>(c) </b>TLR2 and <b>(d) </b>TLR4 in HC, and patients with active and inactive BD. *<it>P </it>&lt; 0.05, **<it>P </it>&lt; 0.01, as determined using the Kruskal-Wallis test with post-hoc Scheffe's test. AU, arbitrary unit; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; NS, not significant.</p>
               </text>
               <graphic file="ar2367-2"/>
            </fig>
            <p>No significant differences were found in levels of TLR2 mRNA expression in PBMCs between patients with active BD, patients with inactive BD, and healthy control individuals (Figure <figr fid="F2">2a</figr>). On the other hand, TLR4 mRNA expression levels were elevated in PBMCs from patients, irrespective of disease activity (Figure <figr fid="F2">2b</figr>) and HLA-B51 phenotype (data not shown). However, no significant differences in levels of mRNA expression for CD14 and MD-2, which are critically involved in LPS-mediated signal transduction of TLR, were found between patients and control individuals (data not shown). There was no abnormality in mRNA expression of TLR2 and TLR4 in PMNs (Figure <figr fid="F2">2c,d</figr>). The results indicate that TLR4 mRNA expression is constitutively increased in PBMCs from BD patients.</p>
         </sec>
         <sec>
            <st>
               <p>Inverse correlation between HO-1 and TLR4 mRNA in PBMCs from BD patients</p>
            </st>
            <p>TLR4 signaling triggers activation of the innate immune system, whereas HO-1 plays a regulatory role in inflammatory response. Analysis of the relationship between the two molecules showed that TLR4 mRNA was inversely correlated with HO-1 mRNA in PBMCs from BD patients (Additional file <supplr sid="S2">2</supplr>; <it>P </it>&lt; 0.05, <it>r </it>= -0.42, by regression analysis). Because LPS (a TLR4 ligand) has been shown to suppress interleukin-10-dependent HO-1 expression in human PBMCs <abbrgrp><abbr bid="B29">29</abbr></abbrgrp>, it is plausible that excessively expressed TLR4 contributes to defective HO-1 expression in PBMCs from BD patients. As expected, the immunoblotting study revealed that stimulation with LPS reduced HO-1 expression in PBMCs from patients with BD, irrespective of the presence or absence of interleukin-10 (Figure <figr fid="F3">3a</figr>). The suppressive effect on HO-1 expression was completely abrogated by a LPS neutrizer, namely polymyxin B (Figure <figr fid="F3">3a</figr>). Similarly, real-time PCR analysis revealed a reduction in HO-1 mRNA levels in LPS-stimulated PBMCs (Figure <figr fid="F4">4a</figr>) when TNF mRNA expression was elevated (Figure <figr fid="F4">4b</figr>). The magnitude of LPS-induced HO-1 suppression (calculated as the gap in HO-1 mRNA between PBMCs subjected to 6 hours of LPS treatment and untreated PBMCs [&#916;HO-1]) was significantly correlated with TLR4 mRNA expression levels in untreated PBMCs (Figure <figr fid="F4">4c</figr>).</p>
            <suppl id="S2">
               <title>
                  <p>Additional file 2</p>
               </title>
               <text>
                  <p>The correlation between HO-1 and TLR4 mRNA levels in PBMCs from patients with BD.</p>
               </text>
               <file name="ar2367-S3.TIFF">
                  <p>Click here for file</p>
               </file>
            </suppl>
            <fig id="F3">
               <title>
                  <p>Figure 3</p>
               </title>
               <caption>
                  <p>Effects of HSP60 and LPS on HO-1 protein expression in PBMCs from patients with BD</p>
               </caption>
               <text>
                  <p>Effects of HSP60 and LPS on HO-1 protein expression in PBMCs from patients with BD. <b>(a) </b>Effect of lipopolysaccharide (LPS) stimulation on heme oxygenase (HO)-1 and actin protein expression in peripheral blood mononuclear cells (PBMCs) from patients with Beh&#231;et's disease (BD). PBMCs from a BD patient were stimulated with LPS in the presence or absence of 10 ng/ml interleukin (IL)-10 and 100 &#956;g/ml polymyxin B (PMB). Representative immunoblotting data for HO-1 protein in the cells are shown. The arrowhead indicates 32 kDa molecular weight HO-1 specific band. <b>(b) </b>Effect of heat shock protein (HSP)60 (3 &#956;g/ml) stimulation on endogenous HO-1 protein expression in PBMCs from patients with BD. The arrowhead indicates 32 kDa HO-1 specific band. A representative of three independent experiments is shown. <b>(c) </b>Mean and standard error of the mean (SEM) values of HO-1 and actin protein expression in PBMCs stimulated by LPS (1 ng/ml) for 24 hours in patients with BD (<it>n </it>= 14). <sup>#</sup><it>P </it>&lt; 0.001, as determined using paired <it>t</it>-test. <b>(d) </b>Effect of infliximab (10 &#956;g/ml) or IgG<sub>1</sub>&#954; (10 &#956;g/ml) on HO-1 expression in LPS (10 ng/ml) or tumor necrosis factor (TNF; 1 ng/ml) treated PBMCs.</p>
               </text>
               <graphic file="ar2367-3"/>
            </fig>
            <fig id="F4">
               <title>
                  <p>Figure 4</p>
               </title>
               <caption>
                  <p>Effect of LPS on HO-1 mRNA expression in PBMCs from BD patients</p>
               </caption>
               <text>
                  <p>Effect of LPS on HO-1 mRNA expression in PBMCs from BD patients. Expression of <b>(a) </b>heme oxygenase (HO)-1 and <b>(b) </b>tumor necrosis factor (TNF) mRNA in peripheral blood mononuclear cells (PBMCs) from patients with Beh&#231;et's disease (BD; <it>n </it>= 18). Values presented are mean and standard error of the mean (SEM) change, regarding 1 to be the value of untreated cells. <sup>#</sup><it>P </it>&lt; 0.001, as determined using paired <it>t</it>-test. <b>(c) </b>Relationship of endogenous Toll-like receptor (TLR)4 mRNA with gap in HO-1 mRNA between PBMCs subjected to 6 hours of treatment with lipopolysaccharide (LPS) and untreated PBMCs (&#916;HO-1). <it>P </it>= 0.02, <it>r </it>= 0.53, as determined by regression analysis. AU, arbitrary unit; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.</p>
               </text>
               <graphic file="ar2367-4"/>
            </fig>
            <p>In our previous study <abbrgrp><abbr bid="B26">26</abbr></abbrgrp> we demonstrated that TNF enhances HO-1 mRNA degradation, resulting in a reduction in HO-1 expression in human monocytes. Because TLR4 signaling leads to synthesis of TNF, which may be involved in the reduction in HO-1 expression in PBMCs from patients with BD. However, levels of TNF mRNA did not correlate with those of HO-1 in PBMCs from patients with BD (data not shown). Moreover, although the preliminary experiments confirmed that 10 ng/ml LPS efficiently stimulated PBMCs to produce substantial amounts of TNF protein, anti-TNF-&#945; antibody infliximab did not eliminate the suppressive effect of LPS on HO-1 expression in monocytes <it>in vitro </it>(Additional file <supplr sid="S3">3</supplr>). The findings indicated that the effect is not solely dependent on TNF (Figure <figr fid="F3">3d</figr>).</p>
            <suppl id="S3">
               <title>
                  <p>Additional file 3</p>
               </title>
               <text>
                  <p>The effect of LPS, PMB, and infliximab on TNF-&#945; production by PBMCs. TNF-&#945; levels in supernatants of PBMC-cultured media recovered after 24 hours of stimulation with LPS, with or without PMB and/or infliximab, as determined by ELISA.</p>
               </text>
               <file name="ar2367-S2.TIFF">
                  <p>Click here for file</p>
               </file>
            </suppl>
         </sec>
         <sec>
            <st>
               <p>No effect of forced HO-1 expression on TLR2 and TLR4 mRNA in human PBMCs</p>
            </st>
            <p>Because our previous study demonstrated bidirectory interactions between HO-1 and TNF <abbrgrp><abbr bid="B26">26</abbr></abbrgrp>, we also examined effects of HO-1 upregulation on TLR levels in monocytes. Over-expression of HO-1 protein was confirmed by immunoblotting analysis 24 hours after transfection with pHO-1 (human HO-1 expression vector) into monocytes. Under these conditions, no differences were found in expression levels of TLR2 and TLR4 between HO-1 cDNA transfected monocytes and controls (Figure <figr fid="F5">5</figr>). Taken together, our findings implicate the involvement of excessive TLR4 expression in low levels of HO-1 mRNA expression in PBMCs from patients with BD.</p>
            <fig id="F5">
               <title>
                  <p>Figure 5</p>
               </title>
               <caption>
                  <p>Effect of forced HO-1 expression on Toll-like receptor (TLR)2 and TLR4 mRNA expression in peripheral monocytes</p>
               </caption>
               <text>
                  <p>Effect of forced HO-1 expression on Toll-like receptor (TLR)2 and TLR4 mRNA expression in peripheral monocytes. <b>(a) </b>Immunoblotting analysis of heme oxygenase (HO)-1 and actin in pHO-1 (human HO-1 expression vector) or pCont (control vector) transfected monocytes. The arrow represents HO-1 protein. <b>(b) </b>Real-time PCR analysis of TLR2 and TLR4 mRNA expression in pHO-1 transfected peripheral blood mononuclear cells (PBMCs). NS, not significant.</p>
               </text>
               <graphic file="ar2367-5"/>
            </fig>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Discussion</p>
         </st>
         <p>In the present study we found endogenous HO-1 expression to be decreased in PBMCs from patients with active BD. Dysregulation of HO-1 expression is associated with some rheumatic diseases. Our previous studies <abbrgrp><abbr bid="B24">24</abbr><abbr bid="B25">25</abbr></abbrgrp> have demonstrated elevated serum HO-1 levels in patients with adult onset Still's disease and hemophagocytic syndrome, and aberrant expression of HO-1 in synoviocytes from patients with RA. However, reduced HO-1 levels in leukocytes have not been demonstrated in other rheumatic diseases. Evidence suggests that increased expression of HO-1 can benefit the host in a variety of pathologic conditions, including inflammatory changes, whereas a deficiency in HO-1 expression is associated with vigorous inflammation, as demonstrated by studies of HO-1 knockout mice and observed in a patient with HO-1 deficiency <abbrgrp><abbr bid="B22">22</abbr><abbr bid="B23">23</abbr></abbrgrp>. In RA, HO-1-expressing cells were located in the lining and sublining layers, but not in the cartilage-pannus junction, where bone and cartilage are actively destroyed <abbrgrp><abbr bid="B25">25</abbr><abbr bid="B30">30</abbr><abbr bid="B31">31</abbr></abbrgrp>. Furthermore, our previous report <abbrgrp><abbr bid="B26">26</abbr></abbrgrp> demonstrated that selective knockdown of HO-1 expression by using specific small interfering RNA resulted in upregulation of synthesis of proinflammatory cytokines, including interleukin-6, interleukin-8 and TNF, which have been shown to be elevated in sera from BD patients <abbrgrp><abbr bid="B6">6</abbr></abbrgrp>. This suggests that leukocyte function is regulated by HO-1 expressed in the cells <abbrgrp><abbr bid="B26">26</abbr></abbrgrp>. Thus, defective expression of HO-1 may be involved in the inflammation characteristic of BD, especially in patients with active disease.</p>
         <p>Although a pathogenic role of anti-HSP60 specific autoimmune responses has been suggested in BD, abnormal activation of the innate immune system has also been identified in the disease <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B6">6</abbr></abbrgrp>. Furthermore, involvement of TLRs has been shown in other systemic autoimmune diseases <abbrgrp><abbr bid="B16">16</abbr></abbrgrp>. In the present study, expression levels of TLR2 and TLR4 were examined because both TLRs recognize HSP60 as ligands <abbrgrp><abbr bid="B10">10</abbr><abbr bid="B11">11</abbr></abbrgrp>. Actually, HSP60 was reported to be expressed in PBMCs, and in intestinal and mucocutaneous lesions from BD patients <abbrgrp><abbr bid="B32">32</abbr><abbr bid="B33">33</abbr></abbrgrp>. Our findings demonstrated that levels of TLR4 mRNA, but not of TLR2 mRNA, are constitutively increased in PBMCs from patients with BD, regardless of disease activity. The data suggest possible involvement of TLR4 in BD, although TLR4 has been also implicated in other rheumatic diseases <abbrgrp><abbr bid="B13">13</abbr><abbr bid="B34">34</abbr></abbrgrp>. Abnormal expression of TLR4 can predispose to defective HO-1 expression in BD PBMCs, because TLR4 may be a putative HO-1 repressor in hepatic ischemia/reperfusion injury mouse model <abbrgrp><abbr bid="B35">35</abbr></abbrgrp>. Indeed, HO-1 expression was suppressed in PBMCs stimulated with LPS <abbrgrp><abbr bid="B29">29</abbr></abbrgrp>. Moreover, elevated soluble CD14 in plasma of BD patients may further facilitate LPS binding to TLR4 <abbrgrp><abbr bid="B36">36</abbr></abbrgrp>. Interestingly, LPS-induced lung injury in a mouse model was rescued by administration of an HO-1 adenovirus vector <abbrgrp><abbr bid="B20">20</abbr></abbrgrp>; this suggests that HO-1 supplementation may have utility as a strategy for countering TLR4-related inflammation. Such a strategy may also be applicable to BD.</p>
         <p>TNF plays a critical role in the development of BD <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B37">37</abbr><abbr bid="B38">38</abbr></abbrgrp>. Several studies, including ours, have demonstrated that TNF is excessively produced in patients with active BD <abbrgrp><abbr bid="B28">28</abbr><abbr bid="B38">38</abbr></abbrgrp>. Indeed, anti-TNF therapy is effective in the disease, especially for management of ocular lesions <abbrgrp><abbr bid="B39">39</abbr></abbrgrp>. In our previous study <abbrgrp><abbr bid="B26">26</abbr></abbrgrp> we showed that TNF suppresses HO-1 expression levels in human peripheral monocytes, thereby accelerating inflammatory responses; this suggests that excessive TNF levels contribute to defective HO-1 expression. However, no association was found between HO-1 and TNF mRNA levels in circulating PBMCs from patients with BD. In addition, the suppressive effect of LPS on HO-1 was not abrogated by anti-TNF antibody, at least <it>in vitro</it>, although significant synthesis of TNF in response to LPS was confirmed in the experiments (Additional file <supplr sid="S3">3</supplr>). These data, rather, suggest that the effect of LPS is mainly mediated by a pathway distinct from TNF. However, TNF may also contribute to defective HO-1 expression <it>in vivo</it>, because other types of cells also produce TNF in BD. Taken together, our findings suggest that highly expressed TLR4 might contribute to reduced HO-1 expression, leading to an activation of the innate immune system in BD, although other factors including TNF may be involved in the defective HO-1. Because TLRs other than TLR4 are also likely to be involved in the pathogenesis BD <abbrgrp><abbr bid="B17">17</abbr></abbrgrp>, further investigation of molecular mechanisms, including interactions between TLRs and HO-1, are required, especially those that distinguish BD from other inflammatory diseases.</p>
      </sec>
      <sec>
         <st>
            <p>Conclusion</p>
         </st>
         <p>Based on the data presented, we hypothesize that HSP60 stimulates not only antigen-specific autoimmune responses but also the innate immune system through constitutively over-expressed TLR4, which mediates HO-1 reduction in PBMCs, leading to inflammation in BD. Restoration of HO-1 expression might be a promising therapeutic strategy in the disease. Alternatively, specific intervention in TLR4-mediated signals that lead to HO-1 reduction may also be of benefit in BD.</p>
      </sec>
      <sec>
         <st>
            <p>Abbreviations</p>
         </st>
         <p>BD = Beh&#231;et's disease; GAPDH = glyceraldehyde-3-phosphate dehydrogenase; HLA = human leukocyte antigen; HO = heme oxygenase; HSP = heat shock protein; LPS = lipopolysaccharide; PBMC = peripheral blood mononuclear cell; PCR = polymerase chain reaction; PMN = polymorphonuclear leukocyte; RA = rheumatoid arthritis; TLR = Toll-like receptor; TNF = tumor necrosis factor.</p>
      </sec>
      <sec>
         <st>
            <p>Competing interests</p>
         </st>
         <p>The authors have received no financial support or other benefits from commercial sources for the work reported here, and the authors have no other financial interests that could create a potential conflict of interest or the appearance of a conflict of interest with regard to the present study.</p>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>YI designed and organized the study. YK, MT, RW, SM, and MK conducted the laboratory work. YK, MT, RW, SM, MK, AI, HI, SO, AU, NM, and YI were involved in the analysis and interpretation of data. YK, MT, and YI were involved in writing the report. All authors read and approved the final manuscript. The authors thank Mr Tom Kiper for his review.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>This work was supported in part by grants from The Yokohama City University Center of Excellence Program of the Ministry of Education, Culture, Sports, Science and Technology of Japan (Y Ishigatsubo), Research on Specific Disease of the Health Science Research Grants from the Ministry of Health, Labour, and Welfare (Y Ishigatsubo), and the 2006 Strategic Research Project No. K18006 from Yokohama City University (Y Ishigatsubo), and 2004&#8211;2005 grant-in-aid for scientific research (project No. 16590991) from the Ministry of Education, Culture, Sports, and Technology of Japan (M Takeno), and 2005 (Y Kirino) and 2006 (M Takeno) grants from the Yokohama Foundation for Advancement of Medical Science. This study was also supported in part by grants from the Kanagawa Nanbyo Foundation (Y Kirino). The source of funding had no role in the writing of the report or the decision to publish the results.</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>Behcet's disease</p>
            </title>
            <aug>
               <au>
                  <snm>Sakane</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Takeno</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Suzuki</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Inaba</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>N Engl J Med</source>
            <pubdate>1999</pubdate>
            <volume>341</volume>
            <fpage>1284</fpage>
            <lpage>1291</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1056/NEJM199910213411707</pubid>
                  <pubid idtype="pmpid" link="fulltext">10528040</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>Close association of HLA-Bw51 with Behcet's disease</p>
            </title>
            <aug>
               <au>
                  <snm>Ohno</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Ohguchi</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Hirose</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Matsuda</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Wakisaka</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Aizawa</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Arch Ophthalmol</source>
            <pubdate>1982</pubdate>
            <volume>100</volume>
            <fpage>1455</fpage>
            <lpage>1458</lpage>
            <xrefbib>
               <pubid idtype="pmpid">6956266</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>The isolation of a virus as the cause of Behcet's diseases</p>
            </title>
            <aug>
               <au>
                  <snm>Sezer</snm>
                  <fnm>FN</fnm>
               </au>
            </aug>
            <source>Am J Ophthalmol</source>
            <pubdate>1953</pubdate>
            <volume>36</volume>
            <fpage>301</fpage>
            <lpage>315</lpage>
            <xrefbib>
               <pubid idtype="pmpid">13030630</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>Polymerase chain reaction reveals herpes simplex virus DNA in saliva of patients with Behcet's disease</p>
            </title>
            <aug>
               <au>
                  <snm>Lee</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Bang</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Cho</snm>
                  <fnm>YH</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>ES</fnm>
               </au>
               <au>
                  <snm>Sohn</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Arch Dermatol Res</source>
            <pubdate>1996</pubdate>
            <volume>288</volume>
            <fpage>179</fpage>
            <lpage>183</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">8967789</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>Skin hypersensitivity to streptococcal antigens and the induction of systemic symptoms by the antigens in Behcet's disease: a multicenter study. The Behcet's Disease Research Committee of Japan</p>
            </title>
            <aug>
               <au>
                  <cnm>Anonymous</cnm>
               </au>
            </aug>
            <source>J Rheumatol</source>
            <pubdate>1989</pubdate>
            <volume>16</volume>
            <fpage>506</fpage>
            <lpage>511</lpage>
            <xrefbib>
               <pubid idtype="pmpid">2664172</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>Behcet's disease: infectious aetiology, new autoantigens, and HLA-B51</p>
            </title>
            <aug>
               <au>
                  <snm>Direskeneli</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Ann Rheum Dis</source>
            <pubdate>2001</pubdate>
            <volume>60</volume>
            <fpage>996</fpage>
            <lpage>1002</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1753405</pubid>
                  <pubid idtype="pmpid" link="fulltext">11602462</pubid>
                  <pubid idtype="doi">10.1136/ard.60.11.996</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>Excessive function of peripheral blood neutrophils from patients with Behcet's disease and from HLA-B51 transgenic mice</p>
            </title>
            <aug>
               <au>
                  <snm>Takeno</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Kariyone</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Yamashita</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Takiguchi</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Mizushima</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Kaneoka</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Sakane</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Arthritis Rheum</source>
            <pubdate>1995</pubdate>
            <volume>38</volume>
            <fpage>426</fpage>
            <lpage>433</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/art.1780380321</pubid>
                  <pubid idtype="pmpid">7880197</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>Toll-like receptor signalling</p>
            </title>
            <aug>
               <au>
                  <snm>Akira</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Takeda</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Nat Rev Immunol</source>
            <pubdate>2004</pubdate>
            <volume>4</volume>
            <fpage>499</fpage>
            <lpage>511</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/nri1391</pubid>
                  <pubid idtype="pmpid" link="fulltext">15229469</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>Toll-like receptor downstream signaling</p>
            </title>
            <aug>
               <au>
                  <snm>Kawai</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Akira</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Arthritis Res Ther</source>
            <pubdate>2005</pubdate>
            <volume>7</volume>
            <fpage>12</fpage>
            <lpage>19</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1064894</pubid>
                  <pubid idtype="pmpid" link="fulltext">15642149</pubid>
                  <pubid idtype="doi">10.1186/ar1469</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>Cutting edge: heat shock protein 60 is a putative endogenous ligand of the toll-like receptor-4 complex</p>
            </title>
            <aug>
               <au>
                  <snm>Ohashi</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Burkart</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Flohe</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Kolb</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>J Immunol</source>
            <pubdate>2000</pubdate>
            <volume>164</volume>
            <fpage>558</fpage>
            <lpage>561</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">10623794</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>Endocytosed HSP60s use toll-like receptor 2 (TLR2) and TLR4 to activate the toll/interleukin-1 receptor signaling pathway in innate immune cells</p>
            </title>
            <aug>
               <au>
                  <snm>Vabulas</snm>
                  <fnm>RM</fnm>
               </au>
               <au>
                  <snm>Ahmad-Nejad</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>da Costa</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Miethke</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Kirschning</snm>
                  <fnm>CJ</fnm>
               </au>
               <au>
                  <snm>Hacker</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Wagner</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>2001</pubdate>
            <volume>276</volume>
            <fpage>31332</fpage>
            <lpage>31339</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1074/jbc.M103217200</pubid>
                  <pubid idtype="pmpid" link="fulltext">11402040</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>Expression and regulation of Toll-like receptor 2 in rheumatoid arthritis synovium</p>
            </title>
            <aug>
               <au>
                  <snm>Seibl</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Birchler</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Loeliger</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Hossle</snm>
                  <fnm>JP</fnm>
               </au>
               <au>
                  <snm>Gay</snm>
                  <fnm>RE</fnm>
               </au>
               <au>
                  <snm>Saurenmann</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Michel</snm>
                  <fnm>BA</fnm>
               </au>
               <au>
                  <snm>Seger</snm>
                  <fnm>RA</fnm>
               </au>
               <au>
                  <snm>Gay</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Lauener</snm>
                  <fnm>RP</fnm>
               </au>
            </aug>
            <source>Am J Pathol</source>
            <pubdate>2003</pubdate>
            <volume>162</volume>
            <fpage>1221</fpage>
            <lpage>1227</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1851232</pubid>
                  <pubid idtype="pmpid" link="fulltext">12651614</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>Toll-like receptor 2 and toll-like receptor 4 expression on CD64<sup>+ </sup>monocytes in rheumatoid arthritis: comment on the article by Iwahashi et al</p>
            </title>
            <aug>
               <au>
                  <snm>Frasnelli</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>So</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Arthritis Rheum</source>
            <pubdate>2005</pubdate>
            <volume>52</volume>
            <fpage>2227</fpage>
            <lpage>2228</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/art.21113</pubid>
                  <pubid idtype="pmpid" link="fulltext">15986336</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>Expression of Toll-like receptor 2 on CD16<sup>+ </sup>blood monocytes and synovial tissue macrophages in rheumatoid arthritis</p>
            </title>
            <aug>
               <au>
                  <snm>Iwahashi</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Yamamura</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Aita</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Okamoto</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Ueno</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Ogawa</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Akashi</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Miyake</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Godowski</snm>
                  <fnm>PJ</fnm>
               </au>
               <au>
                  <snm>Makino</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Arthritis Rheum</source>
            <pubdate>2004</pubdate>
            <volume>50</volume>
            <fpage>1457</fpage>
            <lpage>1467</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/art.20219</pubid>
                  <pubid idtype="pmpid" link="fulltext">15146415</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>Expansion of toll-like receptor 9-expressing B cells in active systemic lupus erythematosus: implications for the induction and maintenance of the autoimmune process</p>
            </title>
            <aug>
               <au>
                  <snm>Papadimitraki</snm>
                  <fnm>ED</fnm>
               </au>
               <au>
                  <snm>Choulaki</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Koutala</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Bertsias</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Tsatsanis</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Gergianaki</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Raptopoulou</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Kritikos</snm>
                  <fnm>HD</fnm>
               </au>
               <au>
                  <snm>Mamalaki</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Sidiropoulos</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Boumpas</snm>
                  <fnm>DT</fnm>
               </au>
            </aug>
            <source>Arthritis Rheum</source>
            <pubdate>2006</pubdate>
            <volume>54</volume>
            <fpage>3601</fpage>
            <lpage>3611</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/art.22197</pubid>
                  <pubid idtype="pmpid" link="fulltext">17075805</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>Toll-like receptors in systemic autoimmune disease</p>
            </title>
            <aug>
               <au>
                  <snm>Marshak-Rothstein</snm>
                  <fnm>A</fnm>
               </au>
            </aug>
            <source>Nat Rev Immunol</source>
            <pubdate>2006</pubdate>
            <volume>6</volume>
            <fpage>823</fpage>
            <lpage>835</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/nri1957</pubid>
                  <pubid idtype="pmpid" link="fulltext">17063184</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>The role of heat shock proteins in Behcet's disease</p>
            </title>
            <aug>
               <au>
                  <snm>Direskeneli</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Saruhan-Direskeneli</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Clin Exp Rheumatol</source>
            <pubdate>2003</pubdate>
            <volume>21</volume>
            <fpage>S44</fpage>
            <lpage>S48</lpage>
            <xrefbib>
               <pubid idtype="pmpid">14727460</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>Heme oxygenase-1: unleashing the protective properties of heme</p>
            </title>
            <aug>
               <au>
                  <snm>Otterbein</snm>
                  <fnm>LE</fnm>
               </au>
               <au>
                  <snm>Soares</snm>
                  <fnm>MP</fnm>
               </au>
               <au>
                  <snm>Yamashita</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Bach</snm>
                  <fnm>FH</fnm>
               </au>
            </aug>
            <source>Trends Immunol</source>
            <pubdate>2003</pubdate>
            <volume>24</volume>
            <fpage>449</fpage>
            <lpage>455</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S1471-4906(03)00181-9</pubid>
                  <pubid idtype="pmpid" link="fulltext">12909459</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>Heme oxygenase-1: the 'emerging molecule' has arrived</p>
            </title>
            <aug>
               <au>
                  <snm>Morse</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Choi</snm>
                  <fnm>AM</fnm>
               </au>
            </aug>
            <source>Am J Respir Cell Mol Biol</source>
            <pubdate>2002</pubdate>
            <volume>27</volume>
            <fpage>8</fpage>
            <lpage>16</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">12091240</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>Transfer of heme oxygenase 1 cDNA by a replication-deficient adenovirus enhances interleukin 10 production from alveolar macrophages that attenuates lipopolysaccharide-induced acute lung injury in mice</p>
            </title>
            <aug>
               <au>
                  <snm>Inoue</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Suzuki</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Nagashima</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Suzuki</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Hashiba</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Tsuburai</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Ikehara</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Matsuse</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Ishigatsubo</snm>
                  <fnm>Y</fnm>
               </au>
            </aug>
            <source>Hum Gene Ther</source>
            <pubdate>2001</pubdate>
            <volume>12</volume>
            <fpage>967</fpage>
            <lpage>979</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1089/104303401750195926</pubid>
                  <pubid idtype="pmpid" link="fulltext">11387061</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>Chemical induction of HO-1 suppresses lupus nephritis by reducing local iNOS expression and synthesis of anti-dsDNA antibody</p>
            </title>
            <aug>
               <au>
                  <snm>Takeda</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Takeno</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Iwasaki</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Kobayashi</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Kirino</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Ueda</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Nagahama</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Aoki</snm>
                  <fnm>I</fnm>
               </au>
               <au>
                  <snm>Ishigatsubo</snm>
                  <fnm>Y</fnm>
               </au>
            </aug>
            <source>Clin Exp Immunol</source>
            <pubdate>2004</pubdate>
            <volume>138</volume>
            <fpage>237</fpage>
            <lpage>244</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1809216</pubid>
                  <pubid idtype="pmpid" link="fulltext">15498032</pubid>
                  <pubid idtype="doi">10.1111/j.1365-2249.2004.02594.x</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>Reduced stress defense in heme oxygenase 1-deficient cells</p>
            </title>
            <aug>
               <au>
                  <snm>Poss</snm>
                  <fnm>KD</fnm>
               </au>
               <au>
                  <snm>Tonegawa</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci USA</source>
            <pubdate>1997</pubdate>
            <volume>94</volume>
            <fpage>10925</fpage>
            <lpage>10930</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">23533</pubid>
                  <pubid idtype="pmpid" link="fulltext">9380736</pubid>
                  <pubid idtype="doi">10.1073/pnas.94.20.10925</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>Oxidative stress causes enhanced endothelial cell injury in human heme oxygenase-1 deficiency</p>
            </title>
            <aug>
               <au>
                  <snm>Yachie</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Niida</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Wada</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Igarashi</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Kaneda</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Toma</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Ohta</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Kasahara</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Koizumi</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>J Clin Invest</source>
            <pubdate>1999</pubdate>
            <volume>103</volume>
            <fpage>129</fpage>
            <lpage>135</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">407858</pubid>
                  <pubid idtype="pmpid">9884342</pubid>
                  <pubid idtype="doi">10.1172/JCI4165</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>Increased serum HO-1 in hemophagocytic syndrome and adult-onset Still's disease: use in the differential diagnosis of hyperferritinemia</p>
            </title>
            <aug>
               <au>
                  <snm>Kirino</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Takeno</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Iwasaki</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Ueda</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Ohno</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Shirai</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Kanamori</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Tanaka</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Ishigatsubo</snm>
                  <fnm>Y</fnm>
               </au>
            </aug>
            <source>Arthritis Res Ther</source>
            <pubdate>2005</pubdate>
            <volume>7</volume>
            <fpage>R616</fpage>
            <lpage>R624</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1174958</pubid>
                  <pubid idtype="pmpid" link="fulltext">15899048</pubid>
                  <pubid idtype="doi">10.1186/ar1721</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B25">
            <title>
               <p>Regulatory role of heme oxygenase 1 in inflammation of rheumatoid arthritis</p>
            </title>
            <aug>
               <au>
                  <snm>Kobayashi</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Takeno</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Saito</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Takeda</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Kirino</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Noyori</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Hayashi</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Ueda</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Ishigatsubo</snm>
                  <fnm>Y</fnm>
               </au>
            </aug>
            <source>Arthritis Rheum</source>
            <pubdate>2006</pubdate>
            <volume>54</volume>
            <fpage>1132</fpage>
            <lpage>1142</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/art.21754</pubid>
                  <pubid idtype="pmpid" link="fulltext">16572448</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>Tumor necrosis factor alpha acceleration of inflammatory responses by down-regulating heme oxygenase 1 in human peripheral monocytes</p>
            </title>
            <aug>
               <au>
                  <snm>Kirino</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Takeno</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Murakami</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Kobayashi</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Kobayashi</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Miura</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Ideguchi</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Ohno</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Ueda</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Ishigatsubo</snm>
                  <fnm>Y</fnm>
               </au>
            </aug>
            <source>Arthritis Rheum</source>
            <pubdate>2007</pubdate>
            <volume>56</volume>
            <fpage>464</fpage>
            <lpage>475</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/art.22370</pubid>
                  <pubid idtype="pmpid" link="fulltext">17265482</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B27">
            <title>
               <p>Criteria for diagnosis of Behcet's disease. International Study Group for Behcet's Disease</p>
            </title>
            <aug>
               <au>
                  <cnm>Anonymous</cnm>
               </au>
            </aug>
            <source>Lancet</source>
            <pubdate>1990</pubdate>
            <volume>335</volume>
            <fpage>1078</fpage>
            <lpage>1080</lpage>
            <xrefbib>
               <pubid idtype="pmpid">1970380</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B28">
            <title>
               <p>Cytokine production profile in patients with Behcet's disease treated with infliximab</p>
            </title>
            <aug>
               <au>
                  <snm>Misumi</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Hagiwara</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Takeno</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Takeda</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Inoue</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Tsuji</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Ueda</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Nakamura</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Ohno</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Ishigatsubo</snm>
                  <fnm>Y</fnm>
               </au>
            </aug>
            <source>Cytokine</source>
            <pubdate>2003</pubdate>
            <volume>24</volume>
            <fpage>210</fpage>
            <lpage>218</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.cyto.2003.09.003</pubid>
                  <pubid idtype="pmpid" link="fulltext">14596817</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B29">
            <title>
               <p>Heme oxygenase 1 expression induced by IL-10 requires STAT-3 and phosphoinositol-3 kinase and is inhibited by lipopolysaccharide</p>
            </title>
            <aug>
               <au>
                  <snm>Ricchetti</snm>
                  <fnm>GA</fnm>
               </au>
               <au>
                  <snm>Williams</snm>
                  <fnm>LM</fnm>
               </au>
               <au>
                  <snm>Foxwell</snm>
                  <fnm>BM</fnm>
               </au>
            </aug>
            <source>J Leukoc Biol</source>
            <pubdate>2004</pubdate>
            <volume>76</volume>
            <fpage>719</fpage>
            <lpage>726</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1189/jlb.0104046</pubid>
                  <pubid idtype="pmpid" link="fulltext">15240748</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B30">
            <title>
               <p>Heme oxygenase 1 (HO-1) regulates osteoclastogenesis and bone resorption</p>
            </title>
            <aug>
               <au>
                  <snm>Zwerina</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Tzima</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Hayer</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Redlich</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Hoffmann</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Hanslik-Schnabel</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Smolen</snm>
                  <fnm>JS</fnm>
               </au>
               <au>
                  <snm>Kollias</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Schett</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>FASEB J</source>
            <pubdate>2005</pubdate>
            <volume>19</volume>
            <fpage>2011</fpage>
            <lpage>2013</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">16234431</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B31">
            <title>
               <p>Localization of tumor necrosis factor alpha in synovial tissues and at the cartilage-pannus junction in patients with rheumatoid arthritis</p>
            </title>
            <aug>
               <au>
                  <snm>Chu</snm>
                  <fnm>CQ</fnm>
               </au>
               <au>
                  <snm>Field</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Feldmann</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Maini</snm>
                  <fnm>RN</fnm>
               </au>
            </aug>
            <source>Arthritis Rheum</source>
            <pubdate>1991</pubdate>
            <volume>34</volume>
            <fpage>1125</fpage>
            <lpage>1132</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/art.1780340908</pubid>
                  <pubid idtype="pmpid">1930331</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B32">
            <title>
               <p>HSP 60 expression in mucocutaneous lesions of Behcet's disease</p>
            </title>
            <aug>
               <au>
                  <snm>Ergun</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Ince</snm>
                  <fnm>U</fnm>
               </au>
               <au>
                  <snm>Eksioglu-Demiralp</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Direskeneli</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Gurbuz</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Gurses</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Aker</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Akoglu</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>J Am Acad Dermatol</source>
            <pubdate>2001</pubdate>
            <volume>45</volume>
            <fpage>904</fpage>
            <lpage>909</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1067/mjd.2001.117728</pubid>
                  <pubid idtype="pmpid" link="fulltext">11712037</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B33">
            <title>
               <p>Involvement of Th1 cells and heat shock protein 60 in the pathogenesis of intestinal Behcet's disease</p>
            </title>
            <aug>
               <au>
                  <snm>Imamura</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Kurokawa</snm>
                  <fnm>MS</fnm>
               </au>
               <au>
                  <snm>Yoshikawa</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Nara</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Takada</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Masuda</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Tsukikawa</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Ozaki</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Matsuda</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Suzuki</snm>
                  <fnm>N</fnm>
               </au>
            </aug>
            <source>Clin Exp Immunol</source>
            <pubdate>2005</pubdate>
            <volume>139</volume>
            <fpage>371</fpage>
            <lpage>378</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1809277</pubid>
                  <pubid idtype="pmpid" link="fulltext">15654837</pubid>
                  <pubid idtype="doi">10.1111/j.1365-2249.2005.02695.x</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B34">
            <title>
               <p>Between adaptive and innate immunity: TLR4-mediated perforin production by CD28null T-helper cells in ankylosing spondylitis</p>
            </title>
            <aug>
               <au>
                  <snm>Raffeiner</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Dejaco</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Duftner</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Kullich</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Goldberger</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Vega</snm>
                  <fnm>SC</fnm>
               </au>
               <au>
                  <snm>Keller</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Grubeck-Loebenstein</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Schirmer</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Arthritis Res Ther</source>
            <pubdate>2005</pubdate>
            <volume>7</volume>
            <fpage>R1412</fpage>
            <lpage>1420</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">1297589</pubid>
                  <pubid idtype="pmpid" link="fulltext">16277694</pubid>
                  <pubid idtype="doi">10.1186/ar1840</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B35">
            <title>
               <p>Toll-like receptor and heme oxygenase-1 signaling in hepatic ischemia/reperfusion injury</p>
            </title>
            <aug>
               <au>
                  <snm>Shen</snm>
                  <fnm>XD</fnm>
               </au>
               <au>
                  <snm>Ke</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Zhai</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Gao</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Busuttil</snm>
                  <fnm>RW</fnm>
               </au>
               <au>
                  <snm>Cheng</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Kupiec-Weglinski</snm>
                  <fnm>JW</fnm>
               </au>
            </aug>
            <source>Am J Transplant</source>
            <pubdate>2005</pubdate>
            <volume>5</volume>
            <fpage>1793</fpage>
            <lpage>1800</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1111/j.1600-6143.2005.00932.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">15996225</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B36">
            <title>
               <p>Monocyte activity in Behcet's disease</p>
            </title>
            <aug>
               <au>
                  <snm>Sahin</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Lawrence</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Direskeneli</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Hamuryudan</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Yazici</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Akoglu</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Br J Rheumatol</source>
            <pubdate>1996</pubdate>
            <volume>35</volume>
            <fpage>424</fpage>
            <lpage>429</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/rheumatology/35.5.424</pubid>
                  <pubid idtype="pmpid" link="fulltext">8646431</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B37">
            <title>
               <p>Cytokines in Behcet's disease</p>
            </title>
            <aug>
               <au>
                  <snm>Sayinalp</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Ozcebe</snm>
                  <fnm>OI</fnm>
               </au>
               <au>
                  <snm>Ozdemir</snm>
                  <fnm>O</fnm>
               </au>
               <au>
                  <snm>Haznedaroglu</snm>
                  <fnm>IC</fnm>
               </au>
               <au>
                  <snm>Dundar</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Kirazli</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>J Rheumatol</source>
            <pubdate>1996</pubdate>
            <volume>23</volume>
            <fpage>321</fpage>
            <lpage>322</lpage>
            <xrefbib>
               <pubid idtype="pmpid">8882039</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B38">
            <title>
               <p>Overproduction of monocyte derived tumor necrosis factor alpha, interleukin (IL) 6, IL-8 and increased neutrophil superoxide generation in Behcet's disease. A comparative study with familial Mediterranean fever and healthy subjects</p>
            </title>
            <aug>
               <au>
                  <snm>Mege</snm>
                  <fnm>JL</fnm>
               </au>
               <au>
                  <snm>Dilsen</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Sanguedolce</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Gul</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Bongrand</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Roux</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Ocal</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Inanc</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Capo</snm>
                  <fnm>C</fnm>
               </au>
            </aug>
            <source>J Rheumatol</source>
            <pubdate>1993</pubdate>
            <volume>20</volume>
            <fpage>1544</fpage>
            <lpage>1549</lpage>
            <xrefbib>
               <pubid idtype="pmpid">8164212</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B39">
            <title>
               <p>Efficacy, safety, and pharmacokinetics of multiple administration of infliximab in Behcet's disease with refractory uveoretinitis</p>
            </title>
            <aug>
               <au>
                  <snm>Ohno</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Nakamura</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Hori</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Shimakawa</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Kawashima</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Mochizuki</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Sugita</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Ueno</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Yoshizaki</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Inaba</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>J Rheumatol</source>
            <pubdate>2004</pubdate>
            <volume>31</volume>
            <fpage>1362</fpage>
            <lpage>1368</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">15229958</pubid>
            </xrefbib>
         </bibl>
      </refgrp>
   </bm>
</art>
