Table 1

Sequences of PCR primers used

Target gene

Sequence


GAPDH forward

5'TGCAGTGGCAAAGTGGAGATT3'

GAPDH reverse

5'ATTTGCCGTGAGTGGAGTCAT3'

IL-6 forward

5'GGAGAGGAGACTTCACAG3'

IL-6 reverse

5'GCCATTGCACAACTCTTTTC3'

TNF-α forward

5'CATCTTCTCAAAATTCGAGTGACAA3'

TNF-α reverse

5'TGGGAGTAGACAAGGTACAACCC3'

h-PGDS forward

5'ATCCAAGGCTGGTGACTTTACG3'

h-PGDS reverse

5'TGAAGGCAACATGGATCAGCTA3'


GAPDH, glyceraldehyde 3-phosphate dehydrogenase; h-PGDS, hematopoietic prostaglandin D synthase; IL, interleukin; PCR, polymerase chain reaction; TNF, tumor necrosis factor.

Jung et al. Arthritis Research & Therapy 2007 9:R64   doi:10.1186/ar2222

Open Data