Table 1

Sequences of primers and probes for quantitative real-time polymerase chain reaction

Gene

GenBank accession no.

Primers (5'→3')

Conc. (nM)

Probe (5'→3')

MgCl2 (mM)


GAPDH

NM_002046

Forward: GAAGGTGAAGGTCGGAGTC

50

CAAGCTTCCCGTTCTCAGCC

5.5

Reverse: GAAGATGGTGATGGGATTTC

900

TOB1

NM_005749

Forward: TCTGCTGCTGTAAGCCCTACCT

300

CGGTCCACTCAGCCTTTAACCTTTACCACT

6.5

Reverse: TTCATTTTGGTAGAGCCGAACTT

900

Ki-67

NM_002417

Forward: CAGTGATCAACGCCGTAGGTC

900

CTTCCAGCAGCAAATCTCAGACAGAGGTTC

6.0

Reverse: TCGGCTGATAGACACTCTCTTTTG

900

COL2A1

NM_001844

Forward:CAACACTGCCAACGTCCAGAT

50

ACCTTCCTACGCCTGCTGTCCACG

5.5

Reverse: CTGCTTCGTCCAGATAGGCAAT

300

MMP-13

NM_002427

Forward: TCCTCTTCTTGAGCTGGACTCATT

900

TCCTCAGACAAATCATCTTCATCACCACCAC

7.0

Reverse: CGCTCTGCAAACTGGAGGTC

50


GAPDH, glyceraldehyde-3-phosphate dehydrogenase; MMP, matrix metalloproteinase; COL2A1, collagen type II (alpha 1 chain); TOB1, Transducer of ERBB2.

Gebauer et al. Arthritis Res Ther 2005 7:R274-R284   doi:10.1186/ar1479

Open Data