Table 1

Primers for real-time PCR
 Target  NCBI number   Forward primer, 5'-3'   Reverse primer, 5'-3'
β-catenin AF_121265.1 GCCAGTGGATTCCGTACTGT GAGCTTGCTTTCCTGATTGC
Wnt1 NM_001105714.1 TCCTCATGAACCTTCACAATAACGA TTGCACTCTTGGCGCATCTC
Wnt3a NM_001105715.1 TGTGAGGTGAAGACCTGCTG AAAGTTGGGGGAGTTCTCGT
Wnt4 NM_053402.1 GAAACGTGCGAGAAGCTCAAAG AAAGGACTGTGAGAAGGCTACG
Wnt5a NM_022631.1 TGCCACTTGTATCAGGACCA TGTCTCTCGGCTGCCTATTT
Wnt5b NM_001100489.1 TGACTACTGCCTGCGAAATG AAAGCAACACCAGTGGAACC
Wnt6 NM_001108226.1 GTCGACTTTGGGGATGAGAA AAAGCCCATGGCACTTACAC
Wnt10a NM_001108227.1 GTTCCTAGCTCAGGCAGGTG AAGTCTGTGGAGGGGGAGAT
Wnt10b NM_001108111.1 CTGGTGCTGTTACGTGCTGT GGAGCCATGATTAACCGAAA
Wnt16 NM_001109223.1 TGGCTGTAACCTCCTCTGCT GAGGCAATCTCATGCTAGGC
LRP5 NM_001106321.2 CATCCATGCTGTGGAGGA TGTCTCGGGCACAAGGAT
LRP6 NM_001107892.1 CATGATACGAAGGCACAAGAA TCTGATTTGGAACCGAGCTT
LEF1 NM_130429.1 TGGTAAACGAGTCCGAAATCA TGTGTTTGTCCGACCACCT
TCF4 NM_053369.1 TCCAACCCTTCAACTCCTGT CGTTTCGAGACCAAACAGC
TNF-α NM_012675.3 TGAACTTCGGGGTGATCG GGGCTTGTCACTCGAGTTTT
TNFR1 NM_013091.1 AATGAGTGCACCCCTTGC CCTGGGGGTTTGTGACATT
TNFR2 NM_130426.4 GAGGCCCAAGGGTCTCAG GCTGCCATGGGAAGAATC

Transcript and sequence of each primer used in the real-time RT-PCR experiments.

Hiyama et al.

Hiyama et al. Arthritis Research & Therapy 2013 15:R189   doi:10.1186/ar4379

Open Data