Table 1

Gene primers for quantitative PCR analysis
Gene name Forward (5′ to 3′) Reverse (5′ to 3′)
Human IL-29 GAAGCAGTTGCGATTTAGCC GAAGCTCGCTAGCTCCTGTG
Human IL-6 AACCTGAACCTTCCAAAGATGG TCTGGCTTGTTCCTCACTACT
Human IL-8 CATACTCCAAACCTTTCCACCCC TCAGCCCTCTTCAAAAACTTCTCCA
Human TLR2 TGTTGCAAGCAGGATCCAAAG CACAAAGTATGTGGCATTGTCCAG
Human TLR3 GGACTTTGAGGCGGGTGTT TGTTGAACTGCATGATGTAC CTTGA
Human TLR4 AGGATGATGCCAGCATGATGTC TCAGGTCCAGGTTCTTGGTTGAG
Human GAPDH AGAAGGCTGGGGCTCATTTG AGGGGCCATCCACAGTCTTC

Xu et al.

Xu et al. Arthritis Research & Therapy 2013 15:R170   doi:10.1186/ar4357

Open Data