Table 1

Beacon designer sequences and real-time reaction efficiencies of qPCR assays
Gene Accession number Sequences nM Efficiency
iNOS U14640 Probe:5′-FAM-
    CGCGATC
CCTGCTTGGTGGCGAAGATGAGC
    GATCGCG
-
200
DABCYL-3′ 200 2.01
Forward: 5′-GTAACAAAGGAGATAGAAACAACAGG-3′ 200 (± 0.08)
Reverse: 5′-CAGCTCCGGGCGTCAAAG-3′
Probe: 5′-FAM-
COX-2 AF031698
    CGCGATC
GTCAGAAATTCGGGTGTGGTACAGTT
    GATCGCG
-DABCYL-3′
200
Forward: 5′-CGAGGTGTATGTATGAGTGTAGG-3′ 300 1.99
Reverse: 5′-GTTGGGAGTGGGTTTCAGG-3′= 300 (± 0.04)
Probe: 5′-FAM- 200
Aggrecan U76615
    CGCGATC
CACTCAGCGAGTTGTCAGGTTCTGA
    GATCGCG
-DABCYL-3′
2.05
Forward: 5′-TGGTGTTTGTGACTCTGAGG-3′ 100 (± 0.07)
Reverse: 5′-GATGAAGTAGCAGGGGATGG-3′ 200
Collagen type II X02420 Probe: 5′-FAM-
    CGCGAT
GCGTCAGGTCAGGTCAGCCAT
    ATCGCG
-
DABCYL-3′ 200
Forward: 5′-AAACCCGAACCCAGAACC-3′ 100 1.96
Reverse: 5′-AAGTCCGAACTGTGAGAGG-3′ 100 (± 0.08)
GAPDH U85042 Probe: 5′-HEX-
    CGCGATC
CACCATCTTCCAGGAGCGAGATCC
    GATCGCG
-
DABCYL-3′ 200 1.96
Forward: 5′-TTCAACGGCACAGTCAAGG-3′ 200 (± 0.01)
Reverse: 5′-TTCAACGGCACAGTCAAGG-3′ 200

Note: Real-time reaction efficiencies of qPCR assays with optimal primer and probe concentrations are shown. Probes contain FAM or HEX as a 5′- reporter dye and DABCYL as 3′- quencher with the arm sequences underlined.

Parker et al.

Parker et al. Arthritis Research & Therapy 2013 15:R163   doi:10.1186/ar4346

Open Data