Table 1

Primers used for real-time RT-PCR.

Target genes

Sequence ( 5' to 3')

Size (bp)


CCL20

F: ACCTGATTTGTGTCCCAGTGGTCT

R: AGCGCCCTTCATAGATTGTGGGAA

175

IL6

F: AACTCCATCTGCCCTTCAGGAACA

R: AAGGCAGTGGCTGTCAACAACATC

101

ADAMTS5

F: GTCCAAATGCACTTCAGCCACGAT

R: AATGTCAAGTTGCACTGCTGGGTG

147

MMP-3

F: ATTGGCACAAAGGTGGATGCTGTC

R: ACGACGCCTTCCATGGATCTTCTT

160

SDC4

F: ACTGAGGTCTTGGCAGCTCTGATT

R: TACACCAGCAGCAGGATCAGGAAA

80

Krt19

F: TGGGTGGCAATGAGAAGATCACCA

R: ATCTTCACCTCCAGCTCGCCATTA

109

Krt8

F: AGCATCATTGCTGAAGTTCGTGCC

R: ATCTGGTACATGGTTTCGGCCTCA

80

Hprt1

F: AGTCCCAGCGTCGTGATTAGTGAT

R: GAGCAAGTCTTTCAGTCCTGTCCA

139


F, forward primer; R, reverse primer.

Markova et al. Arthritis Research & Therapy 2013 15:R121   doi:10.1186/ar4301

Open Data