Table 1

Gene primer sequences used in RNA-Seq validation

Gene

Accession code

Primer sequence


GAPDHa

AF157626

F: GCATCGTGGAGGGACTCA

R: GCCACATCTTCCCAGAGG

TBPa

XM_001502211

F: TGCTGCTGTAATCATGAGGGTAA

R: TCCCGTGCACACCATTTTC

ACTBa

AF035774

F: CCAGCACGATGAAGATCAAG

R: GTGGACAATGAGGCCAGAAT

18Sa

AJ311673

F: GGCGTCCCCCAACTTCTTA

R: GGGCATCACAGACCTGTTATTG

RUNX2

XM_001502519

F: TCCCTGAACTCTGCACCAAG

R: GCCAGGTAGGAGGGGTAAGA

IL7R

NM_001081942

F: GGCTATGCACAGAATGGAGACT

R: CAACTGGCTGTAGCACGAGA

SRPX

XM_001489643

F: CTGAGAACAAGGGCG-TTGC

R: CCGGAGCGTTGAGTTTGC

ACSL5

XM_001915998

F: CCTGGGCTCCTATCTCTTGC

R: CGGAGATGATCCACTCTGGC

DKK

NM_001267802

F: TAGAACCCTGGGACCTCTGG

R: GTGTCACTTTGCAAGCCTGG

ADAMTS4b

NM_001111299

F: CAGCCTGGCTCCTTCAAAAA

R: CCGCAGGAATAGTGACCACAT

COL1A1a

O46388

F: GACTGGCAACCTCAAGAAGG

R: CAATATCCAAGGGAGCCACA

COL2A1a

NM_001081764

F: TCAAGTCCCTCAACAACCAGAT

R: GTCAATCCAGTAGTCTCCGCTCTT

COL10A1a

XM_001504101

F: TGCCCAGTGGACAGGTTTCT

R: GTCTTTTCGTTTCTAGTCAGATTTTGAA

MMP1b

NM_001081847

F: GGTGAAGGAAGGTCAAGTTCTGAT

R: AGTCTTCTACTTTGGAAAAGAGCTTCTCT

MMP13b

NM_001081804

F: CTGGAGCTGGGCACCTACTG

R: ATTTGCCTGAGTCATTATGAACAAGAT

IL1βb

NM_001082526

F: GAGCCCAATCTTCAACATCTATGG

R: CAGGCTTGGTAAAAGGACTTGGTAT

TNFαb

NM_001081819

F: GCTCCAGACGGTGCTTGTG

R: GCCGATCACCCCAAAGTG

TGFβb

NM_001081849

F: CCCTGCCCCTACATTTGGA

R: CGGGTTGTGCTGGTTGTACA


ACSL5, acyl-CoA synthetase long-chain family member 5; ACTB, beta-actin; ADAMTS4, a disintegrin and metalloproteinase with thrombospondin motifs 4; COL1A1, collagen type I, alpha 1; COL2A1, collagen type II, alpha 1; COL10A1, collagen type X, alpha 1; DKK1, dickkopf homolog 1; F, forward; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IL-1β, interleukin 1 beta; IL7R, interleukin 7 receptor; MMP1, matrix metalloproteinase 1; MMP-13, matrix metalloproteinase 13; R, receptor; RUNX2, Runt-related transcription factor 2; 18S, 18 ribosomal RNS; SRPX, Sushi repeat-containing protein; TBP, TATA box binding protein; TGFβ, transforming growth factor beta; TNFα, tumour necrosis factor alpha;. aPrimer pairs previously published in [29]. bPrimer pairs previously published in [28].

Peffers et al. Arthritis Research & Therapy 2013 15:R98   doi:10.1186/ar4278

Open Data