Table 1

Primer sequences for quantitative polymerase chain reaction

Gene name

Primer sequence

Product size

Annealing temperature


ACAN

Forward: 5'-AGGCAGCGTGATCCTTACC-3'

Reverse: 5'-GGCCTCTCCAGTCTCATTCTC-3'

136 bp

60°C


COL2A1

Forward: 5'-CGTCCAGATGACCTTCCTACG-3'

Reverse: 5'-TGAGCAGGGCCTTCTTGAG-3'

122 bp

60°C


SOX9

Forward: 5'-TGGGCAAGCTCTGGAGACTTC-3'

Reverse: 5'-ATCCGGGTGGTCCTTCTTGTG-3'

98 bp

60°C


MMP3

Forward: 5'-TGGCATTCAGTCCCTCTATGG-3'

Reverse: 5'-AGGACAAAGCAGGATCACAGTT-3'

116 bp

60°C


MMP9

Forward: 5'-GGTGATTGACGACGCCTTTGC-3'

Reverse: 5' CGCGACACCAAACTGGATGAC 3'

115 bp

60°C


MMP13

Forward: 5'-AAGGAGCATGGCGACTTCT-3'

Reverse: 5'-TGGCCCAGGAGGAAAAGC-3'

72 bp

60°C


GAPDH

Forward: 5'-CGCTCTCTGCTCCTCCTGTT-3'

Reverse: 5'-CCATGGTGTCTGAGCGATGT-3'

82 bp

60°C


B2M

Forward: 5'-GACTTGTCTTTCAGCAAGGA-3'

Reverse: 5'-ACAAAGTCACATGGTTCACA-3'

106 bp

60°C


Landman et al. Arthritis Research & Therapy 2013 15:R93   doi:10.1186/ar4273

Open Data