Table 2

Primer sequences, annealing temperatures, and cycles used for semiquantitative PCR

Gene

Sense primer (5' → 3')

Antisense primer (5' → 3')

Annealing temperature (ºC)

Cycle


CCL2

agcaagtgtcccaaagaagc

gcaatttccccaagtcctg

66

32

Type I collagen α1

cctggatgccatcaaagtct

ccttcttgaggttgccagtc

66

33

Versican

tcattcaacgtcaccttcca

ggtccaaaaatccaaaccaa

66

34

L-selectin

tcagctgctctgaaggaaca

taaccatgactgccactgga

60

30

CCR1

tcctcacgaaagcctacgaggagagtccaagc

ccacggagaggagggagccatttaac

66

30

CXCL8

cagttttgccaaggagtgct

attgcatctggcaaccctac

63

27

MMP-2

ccaaggagagctgcaacct

ccaaggtccatagctcatcgtc

63

40

CCRL2

ctgggctcatgctggggg

tgcagcagtgggtggtgg

60

30

GAPDH

tgaacgggaagctcactgg

tccaccaccctgttgctgta

60

25

Versican variants

   Versican V0

tcaacatctcatgttctccc

ttcttcactgtgggtataggtcta

57

34

   Versican V1

ggctttgaccagtgcgattac

ttcttcactgtgggtataggtcta

57

28

   Versican V2

tcaacatctcatgttctccc

ccagccatagtcacatgtctc

65

38

   Versican V3

ggctttgaccagtgcgattac

ccagccatagtcacatgtctc

61

32


Masuda et al. Arthritis Research & Therapy 2013 15:R74   doi:10.1186/ar4251

Open Data