Table 2

Primers used for quantitative real-time PCR validation.

Gene symbol

Primer direction1

Primer sequence (5' ~ 3')


BIRC3

F

CATGGGTTCAACATGCCAAGTGGT

BIRC3

R

TTCATCTCCTGGGCTGTCTGATGT

C3

F

GTGGAAATCCGAGCCGTTCTCT

C3

R

GATGGTTACGGTCTGCTGGTGA

CCR2

F

AGTTCAGAAGGTATCTCTCGGTG

CCR2

R

GGCGTGTTTGTTGAAGTCACT

CCR6

F

CTGAACCCTGTGCTCTACGCTT

CCR6

R

CACAGGAGAAGCCTGAGGACTT

CD22

F

GCGCAGCTTGTAATAGTTGGTGC

CD22

R

CACATTGGAGGCTGACCGAGTT

CXCR6

F

CAGTTCAGCAAGGTCTTTCTGCC

CXCR6

R

AGGTTCACCAGGAACACATCCG

EFR3A

F

ATTCAGTGCCATGTGCCATTCCTG

EFR3A

R

GCCCGAAGTTCATCGTTGACTGTT

FOXO1

F

CTACGAGTGGATGGTCAAGAGC

FOXO1

R

CCAGTTCCTTCATTCTGCACACG

FUZ

F

AGCCAGTTGTATCCACAGCTTCTG

FUZ

R

CCGAGGATGTCTGTGTGAAGGG

GM2A

F

TCGTTCCTGGAAATGTGACCCTCA

GM2A

R

CAGCTGCCAATGTAGTCTGTGCAT

GZMA

F

CCACACGCGAAGGTGACCTTAA

GZMA

R

CCTGCAACTTGGCACATGGTTC

IER5

F

ACCTCATCAGCATCTTCGGTTCCA

IER5

R

TTCATGTCTCTCAGCACCGGCTTA

IL6ST

F

CACCCTGTATCACAGACTGGCA

IL6ST

R

TTCAGGGCTTCCTGGTCCATCA

KLRD1

F

GAGCCAGCATTTACTCCAGGAC

KLRD1

R

GCACAGAGATGCCGACTTTCGT

KMO

F

ATACTCGAGTGGCTACCTTCACAC

KMO

R

TCTGATCTTCCAGGCCAACAGCTT

NBN

F

TCTGTCAGGACGGCAGGAAAGA

NBN

R

CACCTCCAAAGACAACTGCGGA

NSMAF

F

GTCTGAACACCTTCACGAGTGG

NSMAF

R

CTGTTCAAGTCTACACCTCCTTC

RNF167

F

ATGGGTCAGTCTTTATTGCGCTGC

RNF167

R

ATCCAGCCTTCTGGGCATTTAGGA

STAT1

F

ATGGCAGTCTGGCGGCTGAATT

STAT1

R

CCAAACCAGGCTGGCACAATTG

TARP

F

CCCCAAGCCCACTATTTTTC

TARP

R

TGTTGCTCTTCTTTTCTTGCC

TNFAIP6

F

TCACCTACGCAGAAGCTAAGGC

TNFAIP6

R

TCCAACTCTGCCCTTAGCCATC

TRAF3

F

AGCAGAGGTTGTGCAGAGCAGTTA

TRAF3

R

TCATCGGAACCTGACTCTTGCAGT

TRGV5

F

TGACTCAGGAAGACCAGCTC

TRGV5

R

TCTTAAAACTCCGGCCCCAC

TRIM4

F

ACGCCACACAGTGGAAGGATAAGA

TRIM4

R

TCTTCAACCAGGAAGTTGTGCAGC

TST

F

TTCCAGCTGGTGGATTCAAGGTCT

TST

R

AGAGATCCACCTTCTTGGTCTGGA

UBTF

F

ATGGATTCATAAGGCCCTGGAGCA

UBTF

R

TTTGTCCGAGAGCTGAGACCACT

XIAP

F

TGGCAGATTATGAAGCACGGATC

XIAP

R

AGTTAGCCCTCCTCCACAGTGA

ZNF277

F

AATGCAGGAAGACCGTGATGGGA

ZNF277

R

AGCGGCTCCAGGATACAATCCTTA


1Forward primer direction (F), reverse primer direction (R).

Jiang et al. Arthritis Research & Therapy 2013 15:R100   doi:10.1186/ar4280

Open Data