Table 1

Matrix metalloproteinase 2 (MMP-2) shRNA sequences

Sequence name

Top and bottom "stem-loop-stem" sequences, 5 to 3


shMMP2a

CACCGCTGAAGGACACCCTCAAGAACGAATTCTTGAGGGTGTCCTTCAGC


AAAAGCTGAAGGACACCCTCAAGAATTCGTTCTTGAGGGTGTCCTTCAGC


shMMP2b

CACCGCCGGGATAAGAAGTATGGATTCTCGAAAGAATCCATACTTCTTATCCCGG


AAAACCGGGATAAGAAGTATGGATTCTTTCGAGAATCCATACTTCTTATCCCGGC


shMMP2c

CACCGCTGTGTTCTTCGCAGGGAATCGAAATTCCCTGCGAAGAACACAGC


AAAAGCTGTGTTCTTCGCAGGGAATTTCGATTCCCTGCGAAGAACACAGC


shMMP2d

CACCGCAATACCTGAACACTTTCTACGAATAGAAAGTGTTCAGGTATTGC


AAAAGCAATACCTGAACACTTTCTATTCGTAGAAAGTGTTCAGGTATTGC


shMMP2e

CACCGTGGTGGTCACAGCTATTTCTTCCGAAGAAGAAATAGCTGTGACCACCA


AAAATGGTGGTCACAGCTATTTCTTCTTCGGAAGAAATAGCTGTGACCACCAC


shNon

CACCGCCGATTAGCTGATCGTGCTTAGTCGAAACTAAGCACGATCAGCTAATCGG


AAAACCGATTAGCTGATCGTGCTTAGTTTCGACTAAGCACGATCAGCTAATCGGC


Rastogi et al. Arthritis Research & Therapy 2013 15:R57   doi:10.1186/ar4224

Open Data