Table 1

Primer and probe sequences.

Gene

Oligonucleotide

Sequence 5' → 3'

Human GAPDH

Forward primer

TCCTACCACCAGCAACCCTGCCA

Reverse primer

GCAACAATATCCACTTTACCAGAGTTAA

Probe

CGCCTGGTCACCAGGGCTGC

Luciferase

Forward primer

ACGGCTTCGGCATGTTCA

Reverse primer

CTCCTCCTCGAAGCGGTACA

Probe

TTGATCTGCGGCTTTCGGGTCGT

Mouse GAPDH

Forward primer

GCATGGCCTTCCGTGTTC

Reverse primer

GATGTCATCATACTTGGCAGGTTT

Mouse IL-6

Probe

TCGTGGATCTGACGTGCCGCC

Forward primer

TCGGAGGCTTAATTACACATGTTC

Reverse primer

CAAGTGCATCATCGTTGTTCATAC

Probe

CAGAATTGCCATTGCACAACTCTTTTCTCA

Mouse iNOS

Forward primer

CCTGGTACGGGCATTGCT

Reverse primer

GCTCATGCGGCCTCCTT

Probe

CAGCAGCGGCTCCATGACTCCC


Paukkeri et al. Arthritis Research & Therapy 2013 15:R51   doi:10.1186/ar4211

Open Data