Table 2

Primer sequences.

Gene

Fwd

Rvs


18S

CATGATTAAGAGGGACGGC

TTCAGCTTTGCAACCATACTC

IL-6

AGTTGCCTTCTTGGGACTGA

GGTAGCATCCATCATTTCTTTGTA

CCL-2

AGAAGTCATAGCCACTCTCAAGG

TGAACTCTCAGACAGCGAGG

VCAM-1

GGAGACCTGTCACTGTCAACTG

TCCATTTCACCACTGTGTAACC

ICAM-1

AGACACAAGCAAGAAGACCACA

TGACCAGTAGAGAAACCCTCG

BGLAP

GCTCTGTCTCTCTGACCTCACA

TAGATGCGTTTGTAGGCGG

CD68

GCTTCTGCTGTGGAAATGC

GGTAGGTTGATTGTCGTCTGC

P4htm

GATTGTGGAGTTCAGTGAGCC

TTCATCATAGGTCCTGTTGTCTG

CD248

GCCAGCAGATGTGTGTCAA

GTAGGTGCCAGCCATAGGAT


Hardy et al. Arthritis Research & Therapy 2013 15:R24   doi:10.1186/ar4158

Open Data