Table 2

Primer sequence used in quantitative PCR

Primer

Forward

Reverse


GAPDH

5'-GGCACAGTCAAGGCTGAGAATG -3'

5'-ATGGTGGTGAAGACGCCAGTA-3'

PRG4

5'- AGGGCGTTGCATCCAAGAA -3'

5'-ACAGTTGCAGGTGGCGTCTCTA-3'

TGF-β1

5'- TGCGCCTGCAGAGATTCAAG -3'

5'- TAACGCCAGGAATTGTTGCTA-3'


GAPDH, glyceraldehyde-3-phosphate dehydrogenase; PRG4, proteoglycan; TGF-β1, transforming growth factor- β1.

Ni et al. Arthritis Research & Therapy 2012 14:R256   doi:10.1186/ar4101

Open Data