Table 2

List of the sequence of gene primers.

Gene name

Forward (5' to 3')

Reverse (5' to 3')


Human IL-29

GAAGCAGTTGCGATTTAGCC

GAAGCTCGCTAGCTCCTGTG

Human IL-28Rα

CCTCCCCAGAATGTGACGC

GGAGCCATGTCAGGTACACG

Human IL-6

AACCTGAACCTTCCAAAGATGG

TCTGGCTTGTTCCTCACTACT

Human IL-8

CATACTCCAAACCTTTCCACCCC

TCAGCCCTCTTCAAAAACTTCTCCA

Human IL-10

CAAATGAAGGATCAGCTGGACAA

GCATCACCTCCTCCAGGTAAAAC

Human IL-17

CCCGGACTGTGATGGTCAAC

GCACTTTGCCTCCCAGATCA

Human MMP-3

CAGGCTTTCCCAAGCAAATA

TTGCATTTGGGTCAAACTCC

Human GAPDH

AGAAGGCTGGGGCTCATTTG

AGGGGCCATCCACAGTCTTC


Wang et al. Arthritis Research & Therapy 2012 14:R228   doi:10.1186/ar4067

Open Data