Table 1

Primer sequences used for real-time reverse transcription-polymerase chain reaction

Primer

Accession number

Direction (5' → 3')

Sequence

Melting temperature, °C

Product length, base pairs

Reference


ADAMTS-4

NM_181667.1

Forward

AACTCGAAGCAATGCACTGGT

54.96

149

[40]

Reverse

TGCCCGAAGCCATTGTCTA

53.16

GAPDH

NM_001034034.1

Forward

ATCAAGAAGGTGGTGAAGCAGG

54.61

101

[40]

Reverse

TGAGTGTCGCTGTTGAAGTCG

55.17

INOS

NM_001076799.1

Forward

GTAACAAAGGAGATAGAAACAACAGG

52.30

146

[16]

Reverse

CAGCTCCGGGCGTCAAAG

55.52

IL-1β

NM_174093.1

Forward

GAGCCTGTCATCTTCGAAACG

59.34

55

This paper

Reverse

GCACGGGTGCGTCACA

60.32

IL-6

NM_173923.2

Forward

GCTTCACAAGCGCCTTCACTCC

64.47

81

This paper

Reverse

GACCCGGGGTAGGGAAAGCAGA

65.73

MMP-13

NM_174389.2

Forward

TGGTCCAGGAGATGAAGACC

52.51

80

[40]

Reverse

TGGCATCAAGGGATAAGGAA

50.22

TLR-4

NM_174198.6

Forward

TGCGTACAGGTTGTTCCTAACATT

54.79

110

This paper

Reverse

TAGTTAAAGCTCAGGTCCAGCATCT

55.50


ADAMTS-4, a disintegrin and metalloproteinase with thrombospondin motifs 4; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IL-1β, interleukin-1 beta; IL-6, interleukin-6; INOS, inducible nitric oxide synthase; MMP-13, matrix metalloproteinase 13; TLR-4, Toll-like receptor 4.

Gorth et al. Arthritis Research & Therapy 2012 14:R179   doi:10.1186/ar3932

Open Data