Table 1

Primers applied in this study

Gene

Sense primer5'-3'

Antisense primer 5'-3'

Size (bp)

Reference


Arp

AATCTCCAGAGGCACCATTG

TTCAGCGTGTTCAGCAGTG

101

NM_007475

Flt-1

CGGCAGACCAATACAATCCT

CCGCTGCCTTATAGATGCTC

174

NM_010228

Flk-1/Kdr

CATGCACAGTCTACGCCAAC

CCTCCACGTGTCTCCATTCT

126

NM_010612

Hgf

GGCCATGGTGCTACACTCTT

CTTCTCCTTGGCCTTGAATG

132

NM_010427

Igf-1

TGGATGCTCTTCAGTTCGTG

GCAACACTCATCCACAATGC

113

NM_010512

Il-1β

CAGGCAGGCAGTATCACTCA

ATGAGTCACAGAGGATGGGC

140

NM_008361

Il-6

TACCACTCCCAACAGACCTGTC

CTGCAAGTGCATCATCGTTGTTC

140

NM_031168

Mdk

CCTGCAACTGGAAGAAGGAA

GAGGTGCAGGGCTTAGTCAC

166

NM_010784

Nrp-1

GGAGCTACTGGGCTGTGAAG

CCTCCTGTGAGCTGGAAGTC

134

NM_008737

Plgf

TGCTGGGAACAACTCAACAG

GGACACAGGACGGACTGAAT

146

NM_008827

Tnf

GACCCTCACACTCAGATCATC

CGCTGGCTCAGCCACTCCAGC

105

NM_013693

Vegf120

GGCTGCTGTAACGATGAAGC

GGCTTGTCACATTTTTCTGGC

184

NM_001025257

Vegf164

GGCTGCTGTAACGATGAAGC

GGCTCACAGTGATTTTCTGGC

184

NM_009505

Vefg188

GGCTGCTGTAACGATGAAGC

CTCACAGTGAACGCTCCAG

255

NM_001025250


Sequences represent primer pairs that were designed using Primer3 design package hosted by the Whitehead Institute for Biomedical Research [55]. References present Genbank accession numbers for each gene. All primer pairs were designed to span an intron to exclude potential genomic DNA contamination. (Arp: acidic ribosomal phosphoprotein P0; Flk-1: fetal liver kinase 1; Flt-1: fms-related tyrosine kinase 1; Hgf: hepatocyte growth factor; Igf-1: insulin-like growth factor; Il: interleukin; Mdk: midkine; Plgf: placental growth factor; Vegf: vascular endothelial growth factor)

Raatz et al. Arthritis Research & Therapy 2012 14:R169   doi:10.1186/ar3922

Open Data