Table 1

Primer details used for RT-PCR analyses

Gene

RT-PCR primer sequences (5' to 3')

Annealing temperature (°C)

Product size (base pairs)

Cycles


Chondrogenic markers

COL type II

Sense: TTTCCCAGGTCAAGATGGTC

58.0

374

35

Antisense: CTTCAGCACCTGTC CACCA

AGN

Sense: TGAGGAGGGCTGGAACAAGTACC

54.0

392

30

Antisense: GGAGGTGGTAATTGCAGGGAACA

COMP

Sense: CAGGACGACTTTGATGCAGA

54.0

312

32

Antisense: AAGCTGGAGCTGTCTGGTA

FMD

Sense: CTTACCCCTATGGGGTGGAT

54.0

389

35

Antisense: GTACATGGCCGTGAGGAAGT

SOX9

Sense: ATCTGAAGAAGGAGAGCGAG

58.0

263

35

Antisense: TCAGAAGTCTCCAGAGCTTG

Hypertrophy and osteogenic markers

COL type X

Sense: CCCTTTTTGCTGCTAGTATCC

54.0

468

25

Antisense: CTGTTGTCCAGGTTTTCCTGGCAC

OP

Sense: ACGCCGACCAAGGAAAACTC

51.0

483

35

Antisense: GTCCATAAACCACACTATCACCTCG

COL type I

Sense: GGACACAATGGATTGCAAGG

54.0

461

32

Antisense: TAACCACTGCTCCACTCTGG

OC

Sense: ATGAGAGCCCTCACACTCCTC

59.0

387

35

Antisense: GCCGTAGAAGCGCCGATAGGC

ALP

Sense: TGGAGCTTCAGAAGCTCAACACCA

51.0

454

35

Antisense: TCTCGTTGTCTGAGTACCAGTCC

Internal control

EF-1α

Sense: AGGTGATTATCCTGAACCATCC

54.0

234

25

Antisense: AAAGGTGGATAGTCTGAGAAGC


AGN, aggrecan core protein; ALP, alkaline phosphatase; COL, collagen; COMP, cartilage oligomeric matrix protein; EF-1α, elongation factor 1α; FMD, fibromodulin; OC, osteocalcin; OP, osteopontin; SOX9, sex determining region Y-box 9.

Steinert et al. Arthritis Research & Therapy 2012 14:R168   doi:10.1186/ar3921

Open Data