Table 1

Primers used for real-time reverse transcription-polymerase chain reaction

Target genes

Sequence (5' to 3')

Size, base pairs


F: TGGCCAAGAAGACATCCCTGAAGT

Collagen type 1

R: ACATCAGGTTTCCACGTCTCACCA

81

F: GAGTGGAAGAGCGGAGACTACTG

Collagen type 2

R: CTCCATGTTGCAGAAGACTTTCA

81

F: TTCATGCATCCGCTAGTCCCTTCT

Collagen type 6

R: CCTTTATTGGGCCATTGGGCATGT

136

F: TCGTGGATGTGGTGCTGAAGATGA

Collagen type 9

R: ATTGGGTCCCTGTTTGCCTGGATA

146

F: TGTCCAACAACCTGTGGAGGAAGA

Fibromodulin

R: CGTTGTGTGTGTGTGTGTGTGTGT

113

F: AAGGACTGTCTATCTGCACGCCAA

Aggrecan

R: TCACCACCCACTCCGAAGAAGTTT

126

F: ATTGGCACAAAGGTGGATGCTGTC

MMP-3

R: ACGACGCCTTCCATGGATCTTCTT

160

F: TTCTCGAATCACGGAGGAAGCCAA

MMP-9

R: AAGGCTGAGTTCAACTTTGCAGGC

89

F: ACTTGTGTGACAGGAGCTAAGGCA

MMP-13

R: AGGAGCATGAAAGGGTGGTCTCAA

119

F: CTGGCCAATGGCATGGATCTCAAA

TNF-α

R: ATGAAATGGCAAATCGGCTGACGG

148

F: ACCTGCTAGTGTGTGATGTTCCCA

IL-1β

R: AGGTGGAGAGCTTTCAGCTCACAT

109

F: ACTTCCAGGCCCATGGTACAATCT

NGF

R: TTGATGTCCGTGGCTGTGGTCTTA

148

F: AGTCCCTGCCCTTTGTACACA

18S

R: GATCCGAGGGCCTCACTAAAC

68


F, forward primer; R, reverse primer; IL-1β, interleukin-1beta; MMP, matrix metalloproteinase; NGF, nerve growth factor; TNF-α, tumor necrosis factor-alpha.

Ponnappan et al. Arthritis Research & Therapy 2011 13:R171   doi:10.1186/ar3494

Open Data