Table 1

Primer sequences for the present study

Primer

Sequence (5' to 3')


Sense

Antisense


TβRI

TTAAAAGGCGCAACCAAGAAC

GTGGTGATGAGCCCTTCGAT

TβRII

GACATCAATCTGAAGCATGAGAACA

GGCGGTGATCAGCCAGTATT

Smad2

GCTGTTTTCCTAGCGTGGCTT

TCCAGACCCACCAGCTGACT

Smad3

GCATCAGCCGCTTCTCAAGT

ATCTCCCCACCATCACCTCC

Smad4

CCTTCTGGAGGAGATCGCT

TCAATGGCTTCTGTCCTGTGG

Smad7

AATGTGTTTTCTAGATTCCCAACTTCTT

CACTCTCGTCTTCTCCTCCCAGTA

Sp1

AGAATTGAGTCACCCAATGAGAACA

GTTGTGTGGCTGTGAGGTCAAG

COL2A1

GGCAATAGCAGGTTCACGTACA

CGATAACAGTCTTGCCCCACTT

COL1A1

CACCAATCACCTGCGGTACAGAA

CAGATCACGTCATCGCACAAC

COL10A1

CCTGGTATGAATGGACAGAAAGG

CCCTGAGGGCCTGGAAGA

Aggrecan

TCGAGGACAGCGAGGCC

TCGAGGGTGTAGCGTGTAGAGA

Sox9

CCC ATG TGG AAG GCA GAT G

TTC TGA GAG GCA CAG GTG ACA


Baugé et al. Arthritis Research & Therapy 2011 13:R23   doi:10.1186/ar3247

Open Data