Table 2

Human oligonucleotide primers

Gene name

Gene symbol

NCBI ref. seq.

Forward primer

Reverse primer


Actin, beta

ACTB

NM_001101.3

CGAGAAGATGACCCAGATCATG

ACAGCCTGGATAGCAACGTACA

Aggrecan

ACAN

NM_001135.2

TCTACCGCTGCGAGGTGAT

TGTAATGGAACACGATGCCTTT

Versican

VCAN

NM_004385.4

GCCTTTCCTATCACCTCGAGAA

CACGGCAACCCAAAATGACT

Collagen, type II, alpha 1

COL2A1

NM_001844.4

GGAAGAGTGGAGACTACTGGATTGAC

TCCATGTTGCAGAAAACCTTCA

Synaptosomal associated protein 25

SNAP25

NM_003081.2

CAATGAGCTGGAGGAGATGCA

TGCTTTCCAGCGACTCATCA

Keratin 8

KRT8

NM_002273.3

CACATCTGTGGTGCTGTCCAT

GCCTTGACCTCAGCAATGATG

Keratin 18

KRT18

NM_000224.2

GCCTACAAGCCCAGATTGC

GGCGAGGTCCTGAGATTTGG

Keratin 19

KRT19

NM_002276.4

CGCAGGGTGCTGGATGAG

AGGTAGGCCAGCTCTTCCTT

N-Cadherin

CDH2

NM_001792.3

AGCCTGGAACGCAGTGTAC

GCGAACCGTCCAGTAGGAT

Integrin-binding sialoprotein

IBSP

NM_004967.3

CCAGAGGAAGCAATCAC

GCACAGGCCATTCCCAA

Tenomodulin

TNMD

NM_022144.2

CAGTGGGTGGTCCCTCAAG

GTCATTTATTGGAAGTTCTTCCTCACTTG

Brain attached signalling protein 1

BASP1

NM_006317.3

GCGGAGCCCGAGAAGAC

GGCCTCAGCAGCTTTGG

Forkhead box F1

FOXF1

NM_001451.2

AAGCCGCCCTATTCCTACATC

GCGCTTGGTGGGTGAACT

Fibulin 1

FBLN1

NM_006487.2

CCTTCGAGTGCCCTGAGAACTA

ACCGATGGCCTCATGCA

T, brachyury homolog (mouse)

T

NM_003181.2

CAATGAGATGATCGTGACCAAGA

GCCAGACACGTTCACCTTCA


Human oligonucleotide primers used for quantitative real-time polymerase chain reaction (qRT-PCR).

Minogue et al. Arthritis Research & Therapy 2010 12:R22   doi:10.1186/ar2929

Open Data