Table 1

Bovine oligonucleotide primers

Gene name

Gene symbol

NCBI ref. seq.

Forward primer

Reverse primer


Glyceraldehyde-3-phosphate dehydrogenase

GAPDH

NM_001034034.1

TGCCGCCTGGAGAAACC

CGCCTGCTTCACCACCTT

Aggrecan

ACAN

NM_173981.2

GGGAGGAGACGACTGCAATC

CCCATTCCGTCTTGTTTTCTG

Versican

VCAN

NM_181035.2

GCTGCATGCCGCCTATG

TCCGTAGGTCCGGACTCCTT

Collagen, type II, alpha 1

COL2A1

NM_001001135.2

CGGGCTGAGGGCAACA

CGTGCAGCCATCCTTCAGA

Synaptosomal associated protein 25

SNAP25

NM_001076246.1

GGCTTCATCCGCAGGGTAA

GCTCCAGGTTTTCATCCATTTC

Keratin 8

KRT8

NM_001033610.1

ACCAGGAGCTCATGAATGTCAA

TCGCCCTCCAGCAGCTT

Keratin 18

KRT18

XM_582930.4

TTGAGCTGCTCCATCTGCAT

AAGGCCAGCTTGGAGAACAG

Keratin 19

KRT19

XM_875997.3

CGGTGCCACCATTGAGAACT

CAAACTTGGTGCGGAAGTCA

N-Cadherin

CDH2

XM_001250829.2

GCCATCAAGCCAGTTGGAA

TGCAGATCGAACCGGGTACT

Sclerostin domain containing 1

SOSTDC1

NM_001046265.1

GTTCAAGTAGGCTGCCGAGAA

GCACTGGCCGTCTGAGATG

Integrin-binding sialoprotein

IBSP

NM_174084.2

GACAGCTATGATGGTCAAGATTACTACA

TGGGTGAACTCATCCCAGTCT

Tenomodulin

TNMD

NM_001099948.1

TCTGGCGTGACGGGTCTT

AAAAAAGGCATTGAACAAAACGA

Brain attached signalling protein 1

BASP1

NM_174780.3

TTGTGGATGAATGCCAACTTTC

AAAAATGGAGTATTGGCATCAAGAT

TNF, alpha-induced protein 6

TNFAIP6

NM_001007813.1

AAGCAGCAGGCGTCTACCA

CACACCGCCTTCGCTTCT

Forkhead box F1

FOXF1

XM_603148.4

TCCCTCCCCACCTCAGAAGT

TGGCTTCAGAAATGCAAGTTACTC

Forkhead box F2

FOXF2

CK941878.1

TGCGTGGTAAGTTTTCACCATCT

CCCCCGGTGAGGTAATGC

Aquaporin 1

AQP1

NM_174702.3

ACCAGGAGGCCCTTAATGGT

CTGTTAAATGGACTAGAAGCGAAATG

Fibulin 1

FBLN1

NM_001098029.1

GCAGCGCAGCCAAGTCAT

AGATATGTCTGGGTGCTACAAACG

T, brachyury homolog (mouse)

T

XM_864890.2

ACTTCGTGGCGGCTGACA

GCACCCACTCCCCATTCA


Bovine oligonucleotide primers used for quantitative real-time polymerase chain reaction (qRT-PCR).

Minogue et al. Arthritis Research & Therapy 2010 12:R22   doi:10.1186/ar2929

Open Data