Table 1

Human oligonucleotide primer sequences used for RT-PCR

Primer Name

Forward Primer

Reverse Primer

Amplicon Size (bp)

Genbank Accession Number


GAPDH

GCCTCCTGCACCACCAAC

GAGCTTGACAAAGTGGTCG

482

[Genbank: NM_002046]

SemaA

GAGACTTGGTATGATTTAGAAG

GCTCTGTGTCAATGACTTCC

618

[Genbank: NM_006080]

SemaF

AGTGTCCGTACGATCCCAAG

CAACAGTGACCACCGTCATC

328

[Genbank: NM_004186]

NRP-1

CTCCTGTTGTGTCTTCAGG

CCCGATGAGGATCGGATTC

396

[Genbank: NM_003873]

NRP-2

CATGCACTATGACACCCCTG

ATGGGTTCCATGCAGTTCTC

756

[Genbank: NM_201266]

PLXA1

GACTTCCTGCTGACCCTGAG

GACTTCAACCTGAAGCCAGC

689

[Genbank: NM_032242]

PLXA2

GCTACAAGAGCTGGGTGGAG

CTCTCGGCTTGAAGAACCAC

538

[Genbank: NM_025179]

PLXA3

CAGCAGATCGACTACAAGAC

GCCGTGTCAGGTAGATCTC

564

[Genbank: NM_017514]

PLXA4

TGTCAGGTGTCAACGAGAGC

ATACACCTGCTCCTTGGTGG

350

[Genbank: NM_020911]

PGP9.5

TGCTGAACAAAGTGCTGTCC

AAAGGCATTCGTCCATCAAG

508

[Genbank: NM_004181]


Tolofari et al. Arthritis Research & Therapy 2010 12:R1   doi:10.1186/ar2898

Open Data