Table 1

Primers used in the study

Primer

Sense/antisense

Sequence


HO-1

Sense

CAGGCAGAGAATGCTGAG

Antisense

GCTTCACATAGCGCTGCA

TLR2

Sense

TGACTGCTCGGAGTTCTCCC

Antisense

GTCAGCACCAGAGCCTGGAG

TLR4

Sense

GCGGCTCGAGGAAGAGAAGA

Antisense

AGGCTCTGATATGCCCCATC

GAPDH

Sense

ACAGTCAGCCGCATC

Antisense

AGGTGCGGCTCCCTA

TNF-α

Sense

ATGAGCACTGAAAGCATGATC

Antisense

GGCGATGCGGCTGATGGT

CD14

Sense

CGGCCGAAGAGTTCACAAGT

Antisense

AGTGCAGTCCTGTGGCTTC

MD-2

Sense

TAAATCTTTTCTGCTTACTGA

Antisense

TACTCAATTTATTCTAATTTGAAT


HO, heme oxygenase; MD, Myeloid differentiation factor-2 ; TLR, Toll-like receptor; TNF, tumor necrosis factor; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Kirino et al. Arthritis Research & Therapy 2008 10:R16   doi:10.1186/ar2367

Open Data